Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224110296:

Variant ID: vg0224110296 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24110296
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCCAACTGTGAGGGGCCGATGACGTCCTCTGTCGAGCCTGAAGCGAAGTCGAAGTCAGTGATGTCGAAGAGCAAGGTGGAAGGCAGCAAGCGGTCCGA[A/C,T]
GAGGTCCCAGCATGGTCCAGTGGTGGACCCTGACTCGACGTGCCGGCTACCTGTGACGAAGTCCCGGTGTACTGCTAGAACTGCGCTGAGTGCGAGGTCG

Reverse complement sequence

CGACCTCGCACTCAGCGCAGTTCTAGCAGTACACCGGGACTTCGTCACAGGTAGCCGGCACGTCGAGTCAGGGTCCACCACTGGACCATGCTGGGACCTC[T/G,A]
TCGGACCGCTTGCTGCCTTCCACCTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGGCCCCTCACAGTTGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.90%	21.30%	37.35%	0.44%	T: 0.02%
All Indica	2759	15.20%	31.00%	53.28%	0.54%	NA
All Japonica	1512	90.30%	0.80%	8.93%	0.00%	NA
Aus	269	35.30%	33.80%	30.48%	0.00%	T: 0.37%
Indica I	595	4.70%	43.90%	49.75%	1.68%	NA
Indica II	465	24.90%	20.20%	54.62%	0.22%	NA
Indica III	913	13.40%	33.60%	52.79%	0.22%	NA
Indica Intermediate	786	19.30%	24.70%	55.73%	0.25%	NA
Temperate Japonica	767	92.00%	0.90%	7.04%	0.00%	NA
Tropical Japonica	504	85.90%	0.40%	13.69%	0.00%	NA
Japonica Intermediate	241	93.80%	1.20%	4.98%	0.00%	NA
VI/Aromatic	96	3.10%	34.40%	57.29%	5.21%	NA
Intermediate	90	56.70%	16.70%	25.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224110296	A -> T	LOC_Os02g39900.1	intron_variant ; MODIFIER	silent_mutation	Average:19.462; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N
vg0224110296	A -> DEL	N	N	silent_mutation	Average:19.462; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N
vg0224110296	A -> C	LOC_Os02g39900.1	intron_variant ; MODIFIER	silent_mutation	Average:19.462; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224110296	NA	2.94E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296	NA	4.82E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296	3.43E-07	4.54E-08	mr1124_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296	NA	3.58E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296	NA	3.87E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251