\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224110296:

Variant ID: vg0224110296 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24110296
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCAACTGTGAGGGGCCGATGACGTCCTCTGTCGAGCCTGAAGCGAAGTCGAAGTCAGTGATGTCGAAGAGCAAGGTGGAAGGCAGCAAGCGGTCCGA[A/C,T]
GAGGTCCCAGCATGGTCCAGTGGTGGACCCTGACTCGACGTGCCGGCTACCTGTGACGAAGTCCCGGTGTACTGCTAGAACTGCGCTGAGTGCGAGGTCG

Reverse complement sequence

CGACCTCGCACTCAGCGCAGTTCTAGCAGTACACCGGGACTTCGTCACAGGTAGCCGGCACGTCGAGTCAGGGTCCACCACTGGACCATGCTGGGACCTC[T/G,A]
TCGGACCGCTTGCTGCCTTCCACCTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGGCCCCTCACAGTTGGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.90% 21.30% 37.35% 0.44% T: 0.02%
All Indica  2759 15.20% 31.00% 53.28% 0.54% NA
All Japonica  1512 90.30% 0.80% 8.93% 0.00% NA
Aus  269 35.30% 33.80% 30.48% 0.00% T: 0.37%
Indica I  595 4.70% 43.90% 49.75% 1.68% NA
Indica II  465 24.90% 20.20% 54.62% 0.22% NA
Indica III  913 13.40% 33.60% 52.79% 0.22% NA
Indica Intermediate  786 19.30% 24.70% 55.73% 0.25% NA
Temperate Japonica  767 92.00% 0.90% 7.04% 0.00% NA
Tropical Japonica  504 85.90% 0.40% 13.69% 0.00% NA
Japonica Intermediate  241 93.80% 1.20% 4.98% 0.00% NA
VI/Aromatic  96 3.10% 34.40% 57.29% 5.21% NA
Intermediate  90 56.70% 16.70% 25.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224110296 A -> T LOC_Os02g39900.1 intron_variant ; MODIFIER silent_mutation Average:19.462; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0224110296 A -> DEL N N silent_mutation Average:19.462; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0224110296 A -> C LOC_Os02g39900.1 intron_variant ; MODIFIER silent_mutation Average:19.462; most accessible tissue: Minghui63 root, score: 29.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224110296 NA 2.94E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296 NA 4.82E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296 3.43E-07 4.54E-08 mr1124_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296 NA 3.58E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224110296 NA 3.87E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251