\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224107167:

Variant ID: vg0224107167 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24107167
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACAGGCCCTAAATTCATCAAGGGCCAGAGGAGCTAAAACTGTATTAGCCATATTTTAGCGAATAAGGCTCGATGCGAATATGTGTTTGGGCTCTGGC[T/C,G]
AGAAAATACTTATAACTTTATCTCACGTATGGTTTGTGAGGAAGCTTCTCTTGAGTACTACCTTCGTTTCAGGTTATAATTAATAAATCTAGACACACAT

Reverse complement sequence

ATGTGTGTCTAGATTTATTAATTATAACCTGAAACGAAGGTAGTACTCAAGAGAAGCTTCCTCACAAACCATACGTGAGATAAAGTTATAAGTATTTTCT[A/G,C]
GCCAGAGCCCAAACACATATTCGCATCGAGCCTTATTCGCTAAAATATGGCTAATACAGTTTTAGCTCCTCTGGCCCTTGATGAATTTAGGGCCTGTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 40.70% 0.11% 0.00% G: 0.78%
All Indica  2759 84.50% 14.10% 0.14% 0.00% G: 1.34%
All Japonica  1512 10.20% 89.80% 0.00% 0.00% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 68.60% 31.00% 0.43% 0.00% NA
Indica III  913 87.00% 10.20% 0.00% 0.00% G: 2.85%
Indica Intermediate  786 79.90% 18.60% 0.13% 0.00% G: 1.40%
Temperate Japonica  767 8.60% 91.40% 0.00% 0.00% NA
Tropical Japonica  504 14.30% 85.70% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224107167 T -> G LOC_Os02g39890.1 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> G LOC_Os02g39890.2 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> G LOC_Os02g39900.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> G LOC_Os02g39890-LOC_Os02g39900 intergenic_region ; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> C LOC_Os02g39890.1 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> C LOC_Os02g39890.2 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> C LOC_Os02g39900.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0224107167 T -> C LOC_Os02g39890-LOC_Os02g39900 intergenic_region ; MODIFIER silent_mutation Average:72.8; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224107167 T C 0.04 0.04 0.05 0.0 0.05 0.05
vg0224107167 T G -0.03 -0.04 -0.04 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224107167 NA 2.95E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 6.31E-10 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 1.67E-06 5.40E-08 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.84E-08 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.48E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 9.37E-08 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 3.52E-06 1.23E-11 mr1130 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 7.88E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.81E-08 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 7.86E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 7.84E-09 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.65E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.17E-08 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 1.16E-06 6.85E-08 mr1256 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 8.35E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 3.02E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 5.91E-06 5.91E-06 mr1465 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 5.85E-06 6.22E-09 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 4.22E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 3.37E-06 5.16E-08 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 3.14E-06 5.10E-08 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.77E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 8.47E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.51E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 4.65E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 6.33E-06 3.71E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.97E-11 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.06E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.51E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 8.16E-06 1.96E-12 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 8.08E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.87E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.01E-11 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 7.91E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.31E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 7.15E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 2.45E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224107167 NA 1.64E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251