\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224094487:

Variant ID: vg0224094487 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24094487
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTAATATTGTTAAAATTTTGGCAGGATGACAATATTATCAAAATTTTGGTAGGATTTCTTATGTATTTAGCAAATCTAGCAACAAACTGAACGTAGA[C/T]
ATTTTTTTAATAACTTAAAAAAGATGGTATGGTTGAAAATAGCATCAAAGGGCTGGTTTGGTTTGTGACCTAAATTGGTCTTACCAATATTTGTCAATGC

Reverse complement sequence

GCATTGACAAATATTGGTAAGACCAATTTAGGTCACAAACCAAACCAGCCCTTTGATGCTATTTTCAACCATACCATCTTTTTTAAGTTATTAAAAAAAT[G/A]
TCTACGTTCAGTTTGTTGCTAGATTTGCTAAATACATAAGAAATCCTACCAAAATTTTGATAATATTGTCATCCTGCCAAAATTTTAACAATATTACCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.00% 0.36% 0.00% NA
All Indica  2759 55.90% 43.80% 0.36% 0.00% NA
All Japonica  1512 99.10% 0.80% 0.13% 0.00% NA
Aus  269 78.10% 21.90% 0.00% 0.00% NA
Indica I  595 50.60% 48.60% 0.84% 0.00% NA
Indica II  465 75.90% 24.10% 0.00% 0.00% NA
Indica III  913 42.80% 57.20% 0.00% 0.00% NA
Indica Intermediate  786 63.10% 36.30% 0.64% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 60.40% 36.50% 3.12% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224094487 C -> T LOC_Os02g39880.1 upstream_gene_variant ; 1367.0bp to feature; MODIFIER silent_mutation Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0224094487 C -> T LOC_Os02g39870.1 downstream_gene_variant ; 216.0bp to feature; MODIFIER silent_mutation Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0224094487 C -> T LOC_Os02g39884.1 downstream_gene_variant ; 3664.0bp to feature; MODIFIER silent_mutation Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0224094487 C -> T LOC_Os02g39870-LOC_Os02g39880 intergenic_region ; MODIFIER silent_mutation Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224094487 NA 7.16E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 1.01E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 4.05E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 2.00E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 8.38E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 2.50E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 4.39E-07 mr1498_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 6.91E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 1.34E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 2.50E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 4.55E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487 NA 1.96E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251