Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224094487:

Variant ID: vg0224094487 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24094487
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGTAATATTGTTAAAATTTTGGCAGGATGACAATATTATCAAAATTTTGGTAGGATTTCTTATGTATTTAGCAAATCTAGCAACAAACTGAACGTAGA[C/T]
ATTTTTTTAATAACTTAAAAAAGATGGTATGGTTGAAAATAGCATCAAAGGGCTGGTTTGGTTTGTGACCTAAATTGGTCTTACCAATATTTGTCAATGC

Reverse complement sequence

GCATTGACAAATATTGGTAAGACCAATTTAGGTCACAAACCAAACCAGCCCTTTGATGCTATTTTCAACCATACCATCTTTTTTAAGTTATTAAAAAAAT[G/A]
TCTACGTTCAGTTTGTTGCTAGATTTGCTAAATACATAAGAAATCCTACCAAAATTTTGATAATATTGTCATCCTGCCAAAATTTTAACAATATTACCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.00%	0.36%	0.00%	NA
All Indica	2759	55.90%	43.80%	0.36%	0.00%	NA
All Japonica	1512	99.10%	0.80%	0.13%	0.00%	NA
Aus	269	78.10%	21.90%	0.00%	0.00%	NA
Indica I	595	50.60%	48.60%	0.84%	0.00%	NA
Indica II	465	75.90%	24.10%	0.00%	0.00%	NA
Indica III	913	42.80%	57.20%	0.00%	0.00%	NA
Indica Intermediate	786	63.10%	36.30%	0.64%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	60.40%	36.50%	3.12%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224094487	C -> T	LOC_Os02g39880.1	upstream_gene_variant ; 1367.0bp to feature; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586	N	N	N	N
vg0224094487	C -> T	LOC_Os02g39870.1	downstream_gene_variant ; 216.0bp to feature; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586	N	N	N	N
vg0224094487	C -> T	LOC_Os02g39884.1	downstream_gene_variant ; 3664.0bp to feature; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586	N	N	N	N
vg0224094487	C -> T	LOC_Os02g39870-LOC_Os02g39880	intergenic_region ; MODIFIER	silent_mutation	Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224094487	NA	7.16E-06	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	1.01E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	4.05E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	2.00E-09	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	8.38E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	2.50E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	4.39E-07	mr1498_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	6.91E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	1.34E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	2.50E-08	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	4.55E-07	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224094487	NA	1.96E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251