\
| Variant ID: vg0224094487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24094487 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )
ATGGTAATATTGTTAAAATTTTGGCAGGATGACAATATTATCAAAATTTTGGTAGGATTTCTTATGTATTTAGCAAATCTAGCAACAAACTGAACGTAGA[C/T]
ATTTTTTTAATAACTTAAAAAAGATGGTATGGTTGAAAATAGCATCAAAGGGCTGGTTTGGTTTGTGACCTAAATTGGTCTTACCAATATTTGTCAATGC
GCATTGACAAATATTGGTAAGACCAATTTAGGTCACAAACCAAACCAGCCCTTTGATGCTATTTTCAACCATACCATCTTTTTTAAGTTATTAAAAAAAT[G/A]
TCTACGTTCAGTTTGTTGCTAGATTTGCTAAATACATAAGAAATCCTACCAAAATTTTGATAATATTGTCATCCTGCCAAAATTTTAACAATATTACCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.00% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 55.90% | 43.80% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.60% | 48.60% | 0.84% | 0.00% | NA |
| Indica II | 465 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 42.80% | 57.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.10% | 36.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 36.50% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224094487 | C -> T | LOC_Os02g39880.1 | upstream_gene_variant ; 1367.0bp to feature; MODIFIER | silent_mutation | Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 | N | N | N | N |
| vg0224094487 | C -> T | LOC_Os02g39870.1 | downstream_gene_variant ; 216.0bp to feature; MODIFIER | silent_mutation | Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 | N | N | N | N |
| vg0224094487 | C -> T | LOC_Os02g39884.1 | downstream_gene_variant ; 3664.0bp to feature; MODIFIER | silent_mutation | Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 | N | N | N | N |
| vg0224094487 | C -> T | LOC_Os02g39870-LOC_Os02g39880 | intergenic_region ; MODIFIER | silent_mutation | Average:70.626; most accessible tissue: Minghui63 panicle, score: 91.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224094487 | NA | 7.16E-06 | mr1185 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 1.01E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 4.05E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 2.00E-09 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 8.38E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 2.50E-08 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 4.39E-07 | mr1498_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 6.91E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 1.34E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 2.50E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 4.55E-07 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224094487 | NA | 1.96E-06 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |