\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224082355:

Variant ID: vg0224082355 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24082355
Reference Allele: GAAlternative Allele: G,AA,GAA
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCACATGGGTGACCCCCTGACCCGGTTGAGATAGAGTGAGCTTAAGGGTGTGTTATAGTTCCTGAAAAAAGTTGGAAGTTTGAAGAAAGTTAGGAGTTT[GA/G,AA,GAA]
AAAAAAAGTTGGAAGTTTATGTGTGTAGGAAATTTTTTTATGTGATATGATGTGATGGAAATTTGGGAATAGGGGGAAACTAAACACGGCCTAACCAAAC

Reverse complement sequence

GTTTGGTTAGGCCGTGTTTAGTTTCCCCCTATTCCCAAATTTCCATCACATCATATCACATAAAAAAATTTCCTACACACATAAACTTCCAACTTTTTTT[TC/C,TT,TTC]
AAACTCCTAACTTTCTTCAAACTTCCAACTTTTTTCAGGAACTATAACACACCCTTAAGCTCACTCTATCTCAACCGGGTCAGGGGGTCACCCATGTGGA

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 14.70% 0.99% 0.17% G: 6.56%; GAA: 3.32%
All Indica  2759 61.00% 21.60% 0.51% 0.29% G: 11.02%; GAA: 5.55%
All Japonica  1512 92.10% 5.60% 2.05% 0.00% G: 0.26%
Aus  269 97.80% 1.50% 0.37% 0.00% GAA: 0.37%
Indica I  595 48.20% 13.90% 1.18% 0.50% G: 34.79%; GAA: 1.34%
Indica II  465 70.50% 25.80% 0.22% 0.43% G: 2.80%; GAA: 0.22%
Indica III  913 60.20% 21.90% 0.00% 0.11% GAA: 13.47%; G: 4.27%
Indica Intermediate  786 65.90% 24.70% 0.76% 0.25% G: 5.73%; GAA: 2.67%
Temperate Japonica  767 89.60% 6.90% 3.26% 0.00% G: 0.26%
Tropical Japonica  504 94.20% 5.00% 0.40% 0.00% G: 0.40%
Japonica Intermediate  241 95.40% 2.90% 1.66% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 85.60% 7.80% 1.11% 0.00% GAA: 3.33%; G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224082355 GA -> G LOC_Os02g39850.1 intron_variant ; MODIFIER silent_mutation Average:91.501; most accessible tissue: Minghui63 flower, score: 98.607 N N N N
vg0224082355 GA -> GAA LOC_Os02g39850.1 intron_variant ; MODIFIER silent_mutation Average:91.501; most accessible tissue: Minghui63 flower, score: 98.607 N N N N
vg0224082355 GA -> DEL N N silent_mutation Average:91.501; most accessible tissue: Minghui63 flower, score: 98.607 N N N N
vg0224082355 GA -> AA LOC_Os02g39850.1 intron_variant ; MODIFIER silent_mutation Average:91.501; most accessible tissue: Minghui63 flower, score: 98.607 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224082355 GA AA 0.02 0.01 0.02 0.0 0.01 0.01
vg0224082355 GA G 0.07 0.12 0.12 0.1 0.16 0.22
vg0224082355 GA GAA -0.11 0.03 0.08 -0.02 0.07 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224082355 1.87E-06 5.61E-06 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251