| Variant ID: vg0224067817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24067817 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTTTTGTAACGTTAGATGAGTACTCCCTTCGTTCAATAAAAAAAAGAATCTAATATAGAATGTGACACATTTTATTTTAGATTTGTTTTTTATAGAACA[T/G]
AAGTACTCTTGTGATTTGTGAAGTAAAATTTTCACTTTGTAAAAAATCCAGAGTTATAGCCAAACGTAGTTTTACCTAAAGGTCTGCACGTGTCGAGACG
CGTCTCGACACGTGCAGACCTTTAGGTAAAACTACGTTTGGCTATAACTCTGGATTTTTTACAAAGTGAAAATTTTACTTCACAAATCACAAGAGTACTT[A/C]
TGTTCTATAAAAAACAAATCTAAAATAAAATGTGTCACATTCTATATTAGATTCTTTTTTTTATTGAACGAAGGGAGTACTCATCTAACGTTACAAAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 33.00% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 7.90% | 91.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 6.80% | 93.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 10.90% | 88.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224067817 | T -> G | LOC_Os02g39830.1 | upstream_gene_variant ; 1328.0bp to feature; MODIFIER | silent_mutation | Average:62.644; most accessible tissue: Callus, score: 89.08 | N | N | N | N |
| vg0224067817 | T -> G | LOC_Os02g39840.1 | downstream_gene_variant ; 516.0bp to feature; MODIFIER | silent_mutation | Average:62.644; most accessible tissue: Callus, score: 89.08 | N | N | N | N |
| vg0224067817 | T -> G | LOC_Os02g39840.3 | downstream_gene_variant ; 516.0bp to feature; MODIFIER | silent_mutation | Average:62.644; most accessible tissue: Callus, score: 89.08 | N | N | N | N |
| vg0224067817 | T -> G | LOC_Os02g39840.2 | downstream_gene_variant ; 2647.0bp to feature; MODIFIER | silent_mutation | Average:62.644; most accessible tissue: Callus, score: 89.08 | N | N | N | N |
| vg0224067817 | T -> G | LOC_Os02g39830-LOC_Os02g39840 | intergenic_region ; MODIFIER | silent_mutation | Average:62.644; most accessible tissue: Callus, score: 89.08 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224067817 | NA | 8.87E-20 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 1.07E-15 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 3.01E-30 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 3.98E-52 | mr1194_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 7.91E-35 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | 4.96E-06 | 3.94E-24 | mr1383_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 9.54E-50 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 6.44E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 9.03E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 1.32E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 8.46E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224067817 | NA | 1.74E-12 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |