Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224056673:

Variant ID: vg0224056673 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24056673
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTGCAGTTAGCAGTCCGAATGAGGGAAACAAAATGCATGAGGAAACTCCTCCCAAAAAAGGACTGATTCTTGCACCAAAGTGACCAAACATTACAGC[G/A]
GTATTAAATTTTTGGTTTTTTAAACTTTAAAATGCTTCTGCTTGAACATTACACAAATTTGCGTAGCGGAAACACATGTCTCAGCACATCATAAGTATAT

Reverse complement sequence

ATATACTTATGATGTGCTGAGACATGTGTTTCCGCTACGCAAATTTGTGTAATGTTCAAGCAGAAGCATTTTAAAGTTTAAAAAACCAAAAATTTAATAC[C/T]
GCTGTAATGTTTGGTCACTTTGGTGCAAGAATCAGTCCTTTTTTGGGAGGAGTTTCCTCATGCATTTTGTTTCCCTCATTCGGACTGCTAACTGCACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.02% 0.00% NA
All Indica  2759 89.60% 10.30% 0.04% 0.00% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 79.10% 20.90% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224056673 G -> A LOC_Os02g39800.1 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0224056673 G -> A LOC_Os02g39820.1 upstream_gene_variant ; 2515.0bp to feature; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0224056673 G -> A LOC_Os02g39810.1 downstream_gene_variant ; 548.0bp to feature; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0224056673 G -> A LOC_Os02g39800-LOC_Os02g39810 intergenic_region ; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224056673 NA 3.95E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 4.25E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.68E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 4.52E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 1.54E-06 1.07E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 3.57E-06 1.07E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.61E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 4.69E-08 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.97E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.76E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.01E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 9.28E-06 2.92E-06 mr1256 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.80E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 3.45E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.20E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 3.81E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 3.80E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 2.54E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 5.22E-07 2.24E-08 mr1868 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 6.23E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 3.35E-07 8.00E-13 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 2.04E-06 8.33E-12 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 5.36E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 2.14E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 2.22E-06 2.06E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 2.08E-11 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 8.75E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 2.67E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.36E-11 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 1.63E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 2.56E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 3.89E-06 5.35E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224056673 NA 4.98E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251