Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224040800:

Variant ID: vg0224040800 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24040800
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGGCTATCTTCTTCTTCTTCCTTTGCCTTCAATGCCAAGTCTTACTTCTTGATGCTTGTCGTTGAGCTTTGGTTGATGTATTGGATGACCTCCTTGGA[G/C]
TCTTGCACAAGCATGTCATGGGCAAGAATGTGTCCAAGCAAATCATGAGGTGTGAGAGTCTTGTAGTCCGGACGCTCACAAATGATGGTAACCAAGGTAG

Reverse complement sequence

CTACCTTGGTTACCATCATTTGTGAGCGTCCGGACTACAAGACTCTCACACCTCATGATTTGCTTGGACACATTCTTGCCCATGACATGCTTGTGCAAGA[C/G]
TCCAAGGAGGTCATCCAATACATCAACCAAAGCTCAACGACAAGCATCAAGAAGTAAGACTTGGCATTGAAGGCAAAGGAAGAAGAAGAAGATAGCCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	17.60%	12.51%	33.90%	NA
All Indica	2759	6.30%	27.70%	14.68%	51.40%	NA
All Japonica	1512	94.80%	0.30%	1.39%	3.51%	NA
Aus	269	10.40%	21.60%	53.53%	14.50%	NA
Indica I	595	5.20%	36.00%	12.94%	45.88%	NA
Indica II	465	4.50%	21.70%	15.05%	58.71%	NA
Indica III	913	6.10%	23.20%	16.54%	54.11%	NA
Indica Intermediate	786	8.30%	30.00%	13.61%	48.09%	NA
Temperate Japonica	767	97.50%	0.10%	0.13%	2.22%	NA
Tropical Japonica	504	89.50%	0.60%	3.57%	6.35%	NA
Japonica Intermediate	241	97.50%	0.00%	0.83%	1.66%	NA
VI/Aromatic	96	18.80%	4.20%	6.25%	70.83%	NA
Intermediate	90	51.10%	5.60%	16.67%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224040800	G -> DEL	N	N	silent_mutation	Average:9.626; most accessible tissue: Callus, score: 25.638	N	N	N	N
vg0224040800	G -> C	LOC_Os02g39790.1	upstream_gene_variant ; 4444.0bp to feature; MODIFIER	silent_mutation	Average:9.626; most accessible tissue: Callus, score: 25.638	N	N	N	N
vg0224040800	G -> C	LOC_Os02g39790.2	upstream_gene_variant ; 4446.0bp to feature; MODIFIER	silent_mutation	Average:9.626; most accessible tissue: Callus, score: 25.638	N	N	N	N
vg0224040800	G -> C	LOC_Os02g39780.1	intron_variant ; MODIFIER	silent_mutation	Average:9.626; most accessible tissue: Callus, score: 25.638	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224040800	NA	1.56E-19	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	1.87E-23	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	3.22E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	1.62E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	8.48E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	1.50E-25	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	2.81E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	1.38E-07	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	4.70E-25	mr1383_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224040800	NA	3.66E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251