\
| Variant ID: vg0224012738 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24012738 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 122. )
ATTTTTATTAATACCGTATAGTGTTCTTTTAATATTTTTATTTTTTATTTTTGAATTTAAGTTGTTTCAAAATTGTATTCCTACTTGAACTCTCTTTTAG[T/C]
TTTTCTAATTTTGGATATTGTTTTATTTTTTATTCTGAATTTTAACTAATCTCATATCGGGTTCTTATATATCTCATATCGGGTTCTTATATGTATTCTT
AAGAATACATATAAGAACCCGATATGAGATATATAAGAACCCGATATGAGATTAGTTAAAATTCAGAATAAAAAATAAAACAATATCCAAAATTAGAAAA[A/G]
CTAAAAGAGAGTTCAAGTAGGAATACAATTTTGAAACAACTTAAATTCAAAAATAAAAAATAAAAATATTAAAAGAACACTATACGGTATTAATAAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 11.80% | 8.68% | 0.76% | NA |
| All Indica | 2759 | 74.40% | 10.80% | 13.63% | 1.16% | NA |
| All Japonica | 1512 | 97.20% | 0.80% | 1.79% | 0.20% | NA |
| Aus | 269 | 33.50% | 65.80% | 0.37% | 0.37% | NA |
| Indica I | 595 | 86.70% | 0.50% | 11.76% | 1.01% | NA |
| Indica II | 465 | 58.50% | 20.90% | 18.71% | 1.94% | NA |
| Indica III | 913 | 78.80% | 10.30% | 10.62% | 0.33% | NA |
| Indica Intermediate | 786 | 69.30% | 13.40% | 15.52% | 1.78% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 94.00% | 2.00% | 3.57% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 58.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224012738 | T -> DEL | N | N | silent_mutation | Average:17.871; most accessible tissue: Callus, score: 41.96 | N | N | N | N |
| vg0224012738 | T -> C | LOC_Os02g39750-LOC_Os02g39764 | intergenic_region ; MODIFIER | silent_mutation | Average:17.871; most accessible tissue: Callus, score: 41.96 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224012738 | 4.37E-06 | NA | mr1069 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 1.81E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 6.88E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 1.99E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 1.75E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 1.33E-06 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 3.26E-09 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 3.29E-09 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 9.38E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 8.21E-06 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 3.61E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224012738 | NA | 8.16E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |