\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224007952:

Variant ID: vg0224007952 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24007952
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GGATCCACCACATACCATATCTTATACGGAAACTAACCTCGAGGGAGTTCCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGGACTACT[C/T]
GGATTGTATCCATATTGGTTTCCCTAATTCTACTTGGACAAGGGGACACATATGGGTATAAATACAAGCCCCTTAGGAGGACAGGGAGACACCCACGATG

Reverse complement sequence

CATCGTGGGTGTCTCCCTGTCCTCCTAAGGGGCTTGTATTTATACCCATATGTGTCCCCTTGTCCAAGTAGAATTAGGGAAACCAATATGGATACAATCC[G/A]
AGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGGAACTCCCTCGAGGTTAGTTTCCGTATAAGATATGGTATGTGGTGGATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 17.00% 0.51% 9.94% NA
All Indica  2759 64.40% 26.40% 0.47% 8.81% NA
All Japonica  1512 98.60% 0.70% 0.00% 0.73% NA
Aus  269 20.40% 19.70% 2.60% 57.25% NA
Indica I  595 83.90% 15.50% 0.17% 0.50% NA
Indica II  465 69.50% 11.40% 0.65% 18.49% NA
Indica III  913 49.00% 42.50% 0.33% 8.21% NA
Indica Intermediate  786 64.50% 24.70% 0.76% 10.05% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 0.40% 0.00% 1.98% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 37.50% 5.20% 4.17% 53.12% NA
Intermediate  90 78.90% 8.90% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224007952 C -> T LOC_Os02g39750.1 upstream_gene_variant ; 1113.0bp to feature; MODIFIER silent_mutation Average:46.368; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0224007952 C -> T LOC_Os02g39740.1 downstream_gene_variant ; 4760.0bp to feature; MODIFIER silent_mutation Average:46.368; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0224007952 C -> T LOC_Os02g39750-LOC_Os02g39764 intergenic_region ; MODIFIER silent_mutation Average:46.368; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0224007952 C -> DEL N N silent_mutation Average:46.368; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224007952 NA 3.59E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 6.55E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 1.10E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 8.67E-06 5.03E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 7.15E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 5.52E-06 1.06E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 6.34E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 7.43E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 9.33E-06 2.60E-07 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 6.81E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 8.86E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 8.65E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 1.53E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 6.35E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 5.74E-06 2.01E-06 mr1813_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 2.16E-06 5.92E-07 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 1.81E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 2.71E-06 6.88E-07 mr1854_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 1.09E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224007952 NA 7.66E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251