| Variant ID: vg0223973381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23973381 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 66. )
AAATAATATCGTATCGGAGGGATCCGAAATTTCAGTCTGATTTGAAATTGGTTTTTCTACTAGGGGACCGAAATTTCGGAAATTTTGAAAAATTTTGGCC[A/G]
AAATTATTTGAAATTTTGACTGATTTTGAAAGAATTTGAATAAATTTTTGACCAAATTCAGAAACTTTTGCAAAAAAAAAAAACCTAAAATTTCAGGCGA
TCGCCTGAAATTTTAGGTTTTTTTTTTTTGCAAAAGTTTCTGAATTTGGTCAAAAATTTATTCAAATTCTTTCAAAATCAGTCAAAATTTCAAATAATTT[T/C]
GGCCAAAATTTTTCAAAATTTCCGAAATTTCGGTCCCCTAGTAGAAAAACCAATTTCAAATCAGACTGAAATTTCGGATCCCTCCGATACGATATTATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.60% | 32.90% | 0.51% | 21.05% | NA |
| All Indica | 2759 | 17.20% | 53.70% | 0.62% | 28.49% | NA |
| All Japonica | 1512 | 88.90% | 3.00% | 0.20% | 7.87% | NA |
| Aus | 269 | 79.90% | 0.40% | 1.12% | 18.59% | NA |
| Indica I | 595 | 3.50% | 80.50% | 0.67% | 15.29% | NA |
| Indica II | 465 | 23.40% | 56.80% | 0.22% | 19.57% | NA |
| Indica III | 913 | 17.70% | 39.50% | 0.44% | 42.28% | NA |
| Indica Intermediate | 786 | 23.20% | 48.10% | 1.02% | 27.74% | NA |
| Temperate Japonica | 767 | 91.50% | 1.70% | 0.13% | 6.65% | NA |
| Tropical Japonica | 504 | 81.70% | 6.00% | 0.20% | 12.10% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.20% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 64.60% | 8.30% | 0.00% | 27.08% | NA |
| Intermediate | 90 | 64.40% | 18.90% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223973381 | A -> G | LOC_Os02g39670.1 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:28.955; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0223973381 | A -> G | LOC_Os02g39680.1 | downstream_gene_variant ; 1299.0bp to feature; MODIFIER | silent_mutation | Average:28.955; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0223973381 | A -> G | LOC_Os02g39680-LOC_Os02g39700 | intergenic_region ; MODIFIER | silent_mutation | Average:28.955; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0223973381 | A -> DEL | N | N | silent_mutation | Average:28.955; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223973381 | NA | 1.62E-45 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 4.60E-12 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 8.83E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 5.12E-28 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 1.68E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 1.39E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 1.28E-20 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 5.59E-06 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 8.82E-06 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223973381 | NA | 1.35E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/