\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223955910:

Variant ID: vg0223955910 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23955910
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TACAAATTGTAAATGACCTGAATGGACTTATGGACACAACAGATTAGAAGTCACGAATTATGGGTTGGGGAGGAAAAGATGTTCTGCCATTGTTTCTTCC[T/G]
AGTCGTATGTCTAATAGTGAATGGAATCAGTTTGTGAAAGAGCAGAAGATATTCTGTTATCCTACTATCCATTGATTCAGGAGCGGGATTATAGCTTTCT

Reverse complement sequence

AGAAAGCTATAATCCCGCTCCTGAATCAATGGATAGTAGGATAACAGAATATCTTCTGCTCTTTCACAAACTGATTCCATTCACTATTAGACATACGACT[A/C]
GGAAGAAACAATGGCAGAACATCTTTTCCTCCCCAACCCATAATTCGTGACTTCTAATCTGTTGTGTCCATAAGTCCATTCAGGTCATTTACAATTTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 32.50% 1.10% 17.84% NA
All Indica  2759 70.80% 4.50% 1.52% 23.16% NA
All Japonica  1512 4.20% 87.80% 0.07% 7.94% NA
Aus  269 66.50% 14.10% 2.23% 17.10% NA
Indica I  595 82.50% 2.50% 1.51% 13.45% NA
Indica II  465 79.40% 2.20% 0.65% 17.85% NA
Indica III  913 60.70% 5.10% 1.42% 32.75% NA
Indica Intermediate  786 68.70% 6.60% 2.16% 22.52% NA
Temperate Japonica  767 1.70% 91.40% 0.13% 6.78% NA
Tropical Japonica  504 8.50% 79.40% 0.00% 12.10% NA
Japonica Intermediate  241 2.90% 94.20% 0.00% 2.90% NA
VI/Aromatic  96 70.80% 2.10% 1.04% 26.04% NA
Intermediate  90 33.30% 50.00% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223955910 T -> G LOC_Os02g39660.1 downstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:47.302; most accessible tissue: Callus, score: 60.461 N N N N
vg0223955910 T -> G LOC_Os02g39660-LOC_Os02g39670 intergenic_region ; MODIFIER silent_mutation Average:47.302; most accessible tissue: Callus, score: 60.461 N N N N
vg0223955910 T -> DEL N N silent_mutation Average:47.302; most accessible tissue: Callus, score: 60.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223955910 8.25E-06 1.79E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 6.54E-06 mr1293_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 5.46E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 2.12E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 1.78E-06 mr1494_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 6.65E-06 1.15E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 1.27E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 4.59E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 9.81E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 NA 6.87E-06 mr1813_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 5.15E-06 6.36E-07 mr1814_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 7.17E-07 8.89E-08 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223955910 2.17E-06 2.63E-07 mr1894_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251