\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223947818:

Variant ID: vg0223947818 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23947818
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAAACATAGTGGATTGTAGGTTGTTTTTAGATAATTTTTGATAATTCGGTCTATTCGGTTACCCGAGGAGACTAACCGAATTGACCGAACAAAATTC[A/G,T]
GTCTTTCACTACCTAGGACCGAATTGATGACCGAATTTCTCGGTCTCGGTCTCGGTCTTTTCGGTTCGGTCTTTTTCTGCCCACCCCTAGCCATCGCAAC

Reverse complement sequence

GTTGCGATGGCTAGGGGTGGGCAGAAAAAGACCGAACCGAAAAGACCGAGACCGAGACCGAGAAATTCGGTCATCAATTCGGTCCTAGGTAGTGAAAGAC[T/C,A]
GAATTTTGTTCGGTCAATTCGGTTAGTCTCCTCGGGTAACCGAATAGACCGAATTATCAAAAATTATCTAAAAACAACCTACAATCCACTATGTTTAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.30% 0.15% 0.00% T: 0.21%
All Indica  2759 43.10% 56.50% 0.25% 0.00% T: 0.11%
All Japonica  1512 92.70% 7.20% 0.00% 0.00% T: 0.13%
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 20.30% 79.50% 0.17% 0.00% NA
Indica II  465 34.00% 65.40% 0.43% 0.00% T: 0.22%
Indica III  913 59.10% 40.70% 0.11% 0.00% NA
Indica Intermediate  786 47.10% 52.30% 0.38% 0.00% T: 0.25%
Temperate Japonica  767 92.40% 7.60% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 8.70% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 96.70% 2.90% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 75.00% 19.80% 0.00% 0.00% T: 5.21%
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223947818 A -> G LOC_Os02g39650.1 upstream_gene_variant ; 1306.0bp to feature; MODIFIER silent_mutation Average:46.157; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0223947818 A -> G LOC_Os02g39650-LOC_Os02g39660 intergenic_region ; MODIFIER silent_mutation Average:46.157; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0223947818 A -> T LOC_Os02g39650.1 upstream_gene_variant ; 1306.0bp to feature; MODIFIER silent_mutation Average:46.157; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0223947818 A -> T LOC_Os02g39650-LOC_Os02g39660 intergenic_region ; MODIFIER silent_mutation Average:46.157; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223947818 NA 9.49E-46 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 3.24E-13 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 2.11E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 2.19E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 3.09E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 5.03E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.19E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.90E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 2.56E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 7.32E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 8.46E-09 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 7.98E-22 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 2.22E-09 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 5.56E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 2.80E-12 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.09E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 4.31E-13 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.80E-10 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 9.49E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 1.69E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.86E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.81E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.42E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 1.71E-06 1.22E-13 mr1124_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 7.74E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 5.25E-09 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.29E-08 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 1.72E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223947818 NA 6.60E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251