\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223926615:

Variant ID: vg0223926615 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23926615
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CATATGTAATTCTAGGAATATTTGTCGAGTCATACTGGATGCAACAGGACGGTCTCATTATGTGCATCCATAAACTTGGGTCGTGGTAGAAAACGGGATG[C/A]
TAGATGGCATGTATAGCAATAACTTTTCTTTTTCTCAAAAAGGCAACGATGTATGCTATGATATCAAGATGAATGAAATGATGCGATGCATGTATGAAAT

Reverse complement sequence

ATTTCATACATGCATCGCATCATTTCATTCATCTTGATATCATAGCATACATCGTTGCCTTTTTGAGAAAAAGAAAAGTTATTGCTATACATGCCATCTA[G/T]
CATCCCGTTTTCTACCACGACCCAAGTTTATGGATGCACATAATGAGACCGTCCTGTTGCATCCAGTATGACTCGACAAATATTCCTAGAATTACATATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 12.50% 0.70% 15.51% NA
All Indica  2759 60.70% 12.00% 1.20% 26.17% NA
All Japonica  1512 98.70% 0.90% 0.00% 0.40% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 39.50% 0.50% 1.51% 58.49% NA
Indica II  465 51.80% 21.30% 1.51% 25.38% NA
Indica III  913 75.40% 12.30% 0.66% 11.72% NA
Indica Intermediate  786 64.90% 14.80% 1.40% 18.96% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 97.20% 2.00% 0.00% 0.79% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 82.20% 12.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223926615 C -> A LOC_Os02g39640-LOC_Os02g39650 intergenic_region ; MODIFIER silent_mutation Average:7.991; most accessible tissue: Callus, score: 36.565 N N N N
vg0223926615 C -> DEL N N silent_mutation Average:7.991; most accessible tissue: Callus, score: 36.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223926615 NA 2.63E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.16E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 7.69E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 3.84E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.57E-06 mr1101 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.43E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 2.23E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 6.58E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.98E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 7.83E-06 2.27E-10 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.26E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 2.65E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 4.19E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 2.00E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 4.34E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 2.35E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 2.41E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 6.82E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223926615 NA 1.83E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251