Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223883799:

Variant ID: vg0223883799 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23883799
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGGACGCGGGGCTATGGGCCTGTTTGGCACAGCTCTAGCTCGAACTCTATCTCTTTTGGAGCTGGAGCTCAGCCAAACAGTTTTAGCTCCAACAAAACTA[G/A]
GAGTAGAGTTGGGTGGAGCTCTCCATACCAAACAGGCCCTATGTTGGCAGCGTGCGAGCGAGAGCGTCGCTGTCGTCGATGGCGATGGTGAGTCGCAGTG

Reverse complement sequence

CACTGCGACTCACCATCGCCATCGACGACAGCGACGCTCTCGCTCGCACGCTGCCAACATAGGGCCTGTTTGGTATGGAGAGCTCCACCCAACTCTACTC[C/T]
TAGTTTTGTTGGAGCTAAAACTGTTTGGCTGAGCTCCAGCTCCAAAAGAGATAGAGTTCGAGCTAGAGCTGTGCCAAACAGGCCCATAGCCCCGCGTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 12.70% 1.59% 7.07% NA
All Indica  2759 74.20% 12.20% 2.28% 11.31% NA
All Japonica  1512 97.40% 0.90% 0.53% 1.26% NA
Aus  269 33.10% 66.20% 0.74% 0.00% NA
Indica I  595 91.10% 0.50% 2.69% 5.71% NA
Indica II  465 61.90% 21.90% 4.09% 12.04% NA
Indica III  913 72.10% 12.70% 1.64% 13.58% NA
Indica Intermediate  786 71.20% 14.60% 1.65% 12.47% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 94.40% 2.00% 0.99% 2.58% NA
Japonica Intermediate  241 97.90% 1.20% 0.41% 0.41% NA
VI/Aromatic  96 37.50% 61.50% 0.00% 1.04% NA
Intermediate  90 81.10% 14.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223883799 G -> A LOC_Os02g39560.1 upstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39570.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39560.2 upstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39570.5 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39570.4 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39570.6 upstream_gene_variant ; 2879.0bp to feature; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> A LOC_Os02g39560-LOC_Os02g39570 intergenic_region ; MODIFIER silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N
vg0223883799 G -> DEL N N silent_mutation Average:98.373; most accessible tissue: Zhenshan97 young leaf, score: 99.844 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223883799 G A 0.02 0.0 -0.02 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223883799 1.93E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 8.77E-09 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.19E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 6.00E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 4.05E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.71E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 4.28E-06 2.61E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 3.36E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.99E-09 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.52E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.11E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.82E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 3.09E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.31E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 7.18E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 4.72E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 3.43E-06 1.48E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.58E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 4.04E-07 8.41E-13 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 1.59E-06 5.12E-12 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.41E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 6.04E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 7.62E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 1.66E-06 1.62E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 7.55E-06 2.86E-11 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 1.41E-07 NA mr1150_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.42E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 2.97E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 9.12E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 7.95E-12 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.40E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.50E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 1.66E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 3.74E-06 1.37E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223883799 NA 4.42E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251