\
| Variant ID: vg0223876476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23876476 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTTAACAAAGAGGTTGATTAGACTTCCTTTTCAAACTTTTTACGATGTTATAGCTCACGAAATTTGTGTGGAAGTTTCAACAAATATAAAATGTAATT[G/A]
ATCGGCAAGGGGGGCTTTGGGGAAATGCTTGCGAGCAGCGTTGAACGTTCAGAAAATTAACACATTATTCCAGTTAAAAATGATATAATTCATAAGAAAG
CTTTCTTATGAATTATATCATTTTTAACTGGAATAATGTGTTAATTTTCTGAACGTTCAACGCTGCTCGCAAGCATTTCCCCAAAGCCCCCCTTGCCGAT[C/T]
AATTACATTTTATATTTGTTGAAACTTCCACACAAATTTCGTGAGCTATAACATCGTAAAAAGTTTGAAAAGGAAGTCTAATCAACCTCTTTGTTAAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 17.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 73.00% | 26.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 53.20% | 46.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.20% | 25.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223876476 | G -> A | LOC_Os02g39550.1 | upstream_gene_variant ; 1626.0bp to feature; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0223876476 | G -> A | LOC_Os02g39550.3 | upstream_gene_variant ; 1626.0bp to feature; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0223876476 | G -> A | LOC_Os02g39550.2 | upstream_gene_variant ; 1595.0bp to feature; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0223876476 | G -> A | LOC_Os02g39560.1 | downstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0223876476 | G -> A | LOC_Os02g39560.2 | downstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0223876476 | G -> A | LOC_Os02g39550-LOC_Os02g39560 | intergenic_region ; MODIFIER | silent_mutation | Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223876476 | NA | 4.26E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 2.93E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 2.26E-09 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 1.05E-08 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 7.75E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 3.49E-10 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 5.60E-09 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 2.14E-08 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 4.57E-09 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 6.63E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 2.73E-09 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 3.94E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 5.48E-11 | mr1996_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223876476 | NA | 2.90E-10 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |