\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223876476:

Variant ID: vg0223876476 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23876476
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTAACAAAGAGGTTGATTAGACTTCCTTTTCAAACTTTTTACGATGTTATAGCTCACGAAATTTGTGTGGAAGTTTCAACAAATATAAAATGTAATT[G/A]
ATCGGCAAGGGGGGCTTTGGGGAAATGCTTGCGAGCAGCGTTGAACGTTCAGAAAATTAACACATTATTCCAGTTAAAAATGATATAATTCATAAGAAAG

Reverse complement sequence

CTTTCTTATGAATTATATCATTTTTAACTGGAATAATGTGTTAATTTTCTGAACGTTCAACGCTGCTCGCAAGCATTTCCCCAAAGCCCCCCTTGCCGAT[C/T]
AATTACATTTTATATTTGTTGAAACTTCCACACAAATTTCGTGAGCTATAACATCGTAAAAAGTTTGAAAAGGAAGTCTAATCAACCTCTTTGTTAAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.20% 0.04% 0.00% NA
All Indica  2759 73.00% 26.90% 0.07% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 53.20% 46.70% 0.11% 0.00% NA
Indica Intermediate  786 74.20% 25.70% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223876476 G -> A LOC_Os02g39550.1 upstream_gene_variant ; 1626.0bp to feature; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N
vg0223876476 G -> A LOC_Os02g39550.3 upstream_gene_variant ; 1626.0bp to feature; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N
vg0223876476 G -> A LOC_Os02g39550.2 upstream_gene_variant ; 1595.0bp to feature; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N
vg0223876476 G -> A LOC_Os02g39560.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N
vg0223876476 G -> A LOC_Os02g39560.2 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N
vg0223876476 G -> A LOC_Os02g39550-LOC_Os02g39560 intergenic_region ; MODIFIER silent_mutation Average:72.594; most accessible tissue: Minghui63 root, score: 85.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223876476 NA 4.26E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 2.93E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 2.26E-09 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 1.05E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 7.75E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 3.49E-10 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 5.60E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 2.14E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 4.57E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 6.63E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 2.73E-09 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 3.94E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 5.48E-11 mr1996_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223876476 NA 2.90E-10 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251