Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223849476:

Variant ID: vg0223849476 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23849476
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAAGTACGATTATATCTGATATATACTTCCTCAGTTTTTTAATGTATAACACTGTTGACTTTTTAAGATATATTTGATCATTCGTCTTGTTTAAAAAA[A/T]
TTATATAATTATTATTTTTAATTTATTATGAGTTGACTTATCATAAAAAAATCTTTAAGCATAACTTAATTTTTTATATTCACATAAAAATTTTAAAAAA

Reverse complement sequence

TTTTTTAAAATTTTTATGTGAATATAAAAAATTAAGTTATGCTTAAAGATTTTTTTATGATAAGTCAACTCATAATAAATTAAAAATAATAATTATATAA[T/A]
TTTTTTAAACAAGACGAATGATCAAATATATCTTAAAAAGTCAACAGTGTTATACATTAAAAAACTGAGGAAGTATATATCAGATATAATCGTACTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	16.60%	0.38%	0.11%	NA
All Indica	2759	73.30%	25.90%	0.58%	0.18%	NA
All Japonica	1512	99.20%	0.70%	0.13%	0.00%	NA
Aus	269	81.40%	18.60%	0.00%	0.00%	NA
Indica I	595	84.50%	15.50%	0.00%	0.00%	NA
Indica II	465	94.60%	2.80%	2.15%	0.43%	NA
Indica III	913	55.20%	44.80%	0.00%	0.00%	NA
Indica Intermediate	786	73.30%	25.60%	0.76%	0.38%	NA
Temperate Japonica	767	98.40%	1.30%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223849476	A -> T	LOC_Os02g39520.1	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:56.074; most accessible tissue: Callus, score: 95.17	N	N	N	N
vg0223849476	A -> T	LOC_Os02g39520.2	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:56.074; most accessible tissue: Callus, score: 95.17	N	N	N	N
vg0223849476	A -> T	LOC_Os02g39510.1	downstream_gene_variant ; 2872.0bp to feature; MODIFIER	silent_mutation	Average:56.074; most accessible tissue: Callus, score: 95.17	N	N	N	N
vg0223849476	A -> T	LOC_Os02g39510-LOC_Os02g39520	intergenic_region ; MODIFIER	silent_mutation	Average:56.074; most accessible tissue: Callus, score: 95.17	N	N	N	N
vg0223849476	A -> DEL	N	N	silent_mutation	Average:56.074; most accessible tissue: Callus, score: 95.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223849476	NA	7.92E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	8.26E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	4.03E-07	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	3.70E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.59E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	2.23E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.21E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	9.53E-09	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	2.46E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.02E-09	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	4.91E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.69E-09	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.46E-07	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.63E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.23E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	1.23E-08	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	4.33E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	2.76E-10	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223849476	NA	4.28E-11	mr1996_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251