| Variant ID: vg0223820416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23820416 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.22, others allele: 0.00, population size: 59. )
ATCCGGCTTTTACAAGAAAGCCAAAGACATTCACAGCAGTTCAGAATCAAACAACGAAAAAAATAAAAAATACTTCCTCCGTTTCACAATGTAAAACTTT[C/T,A]
TAGCATTGCCCACATTCATTTAGATGTTAATGAATCTAGATATATGTATGTGTCTTAGATTCATTAACATATACTCCCTCCGTTTCGAAATGTTTGACAC
GTGTCAAACATTTCGAAACGGAGGGAGTATATGTTAATGAATCTAAGACACATACATATATCTAGATTCATTAACATCTAAATGAATGTGGGCAATGCTA[G/A,T]
AAAGTTTTACATTGTGAAACGGAGGAAGTATTTTTTATTTTTTTCGTTGTTTGATTCTGAACTGCTGTGAATGTCTTTGGCTTTCTTGTAAAAGCCGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 30.00% | 0.66% | 7.45% | A: 0.02% |
| All Indica | 2759 | 48.00% | 41.50% | 0.14% | 10.37% | NA |
| All Japonica | 1512 | 94.40% | 1.10% | 0.99% | 3.51% | NA |
| Aus | 269 | 29.00% | 70.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 50.30% | 17.50% | 0.17% | 32.10% | NA |
| Indica II | 465 | 52.50% | 44.70% | 0.22% | 2.58% | NA |
| Indica III | 913 | 41.00% | 55.60% | 0.00% | 3.40% | NA |
| Indica Intermediate | 786 | 51.80% | 41.30% | 0.25% | 6.62% | NA |
| Temperate Japonica | 767 | 93.60% | 0.50% | 0.13% | 5.74% | NA |
| Tropical Japonica | 504 | 94.80% | 2.00% | 2.78% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 31.20% | 54.20% | 7.29% | 7.29% | NA |
| Intermediate | 90 | 71.10% | 16.70% | 5.56% | 5.56% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223820416 | C -> A | LOC_Os02g39470.1 | upstream_gene_variant ; 592.0bp to feature; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> A | LOC_Os02g39480.1 | downstream_gene_variant ; 825.0bp to feature; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> A | LOC_Os02g39470-LOC_Os02g39480 | intergenic_region ; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> T | LOC_Os02g39470.1 | upstream_gene_variant ; 592.0bp to feature; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> T | LOC_Os02g39480.1 | downstream_gene_variant ; 825.0bp to feature; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> T | LOC_Os02g39470-LOC_Os02g39480 | intergenic_region ; MODIFIER | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| vg0223820416 | C -> DEL | N | N | silent_mutation | Average:38.875; most accessible tissue: Callus, score: 66.211 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223820416 | NA | 1.96E-13 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 4.66E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 3.49E-11 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 1.43E-09 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 7.48E-10 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 5.86E-07 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 1.76E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 7.00E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | 7.25E-06 | NA | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223820416 | NA | 3.27E-09 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/