\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223820416:

Variant ID: vg0223820416 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23820416
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.22, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGGCTTTTACAAGAAAGCCAAAGACATTCACAGCAGTTCAGAATCAAACAACGAAAAAAATAAAAAATACTTCCTCCGTTTCACAATGTAAAACTTT[C/T,A]
TAGCATTGCCCACATTCATTTAGATGTTAATGAATCTAGATATATGTATGTGTCTTAGATTCATTAACATATACTCCCTCCGTTTCGAAATGTTTGACAC

Reverse complement sequence

GTGTCAAACATTTCGAAACGGAGGGAGTATATGTTAATGAATCTAAGACACATACATATATCTAGATTCATTAACATCTAAATGAATGTGGGCAATGCTA[G/A,T]
AAAGTTTTACATTGTGAAACGGAGGAAGTATTTTTTATTTTTTTCGTTGTTTGATTCTGAACTGCTGTGAATGTCTTTGGCTTTCTTGTAAAAGCCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 30.00% 0.66% 7.45% A: 0.02%
All Indica  2759 48.00% 41.50% 0.14% 10.37% NA
All Japonica  1512 94.40% 1.10% 0.99% 3.51% NA
Aus  269 29.00% 70.60% 0.00% 0.37% NA
Indica I  595 50.30% 17.50% 0.17% 32.10% NA
Indica II  465 52.50% 44.70% 0.22% 2.58% NA
Indica III  913 41.00% 55.60% 0.00% 3.40% NA
Indica Intermediate  786 51.80% 41.30% 0.25% 6.62% NA
Temperate Japonica  767 93.60% 0.50% 0.13% 5.74% NA
Tropical Japonica  504 94.80% 2.00% 2.78% 0.40% NA
Japonica Intermediate  241 95.90% 1.20% 0.00% 2.90% NA
VI/Aromatic  96 31.20% 54.20% 7.29% 7.29% NA
Intermediate  90 71.10% 16.70% 5.56% 5.56% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223820416 C -> A LOC_Os02g39470.1 upstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> A LOC_Os02g39480.1 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> A LOC_Os02g39470-LOC_Os02g39480 intergenic_region ; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> T LOC_Os02g39470.1 upstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> T LOC_Os02g39480.1 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> T LOC_Os02g39470-LOC_Os02g39480 intergenic_region ; MODIFIER silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N
vg0223820416 C -> DEL N N silent_mutation Average:38.875; most accessible tissue: Callus, score: 66.211 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223820416 NA 1.96E-13 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 4.66E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 3.49E-11 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.43E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 7.48E-10 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 5.86E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.76E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 7.00E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 7.25E-06 NA mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 3.27E-09 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.68E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 8.04E-08 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 7.72E-11 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 2.51E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 2.75E-16 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.88E-11 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.05E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 9.08E-11 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.15E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 3.60E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 7.85E-06 1.81E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 2.79E-09 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 4.23E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 3.59E-06 5.52E-13 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 1.35E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 3.15E-06 2.01E-08 mr1222_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 5.25E-08 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 6.14E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 8.50E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 4.92E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 3.66E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223820416 NA 3.31E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251