Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223737012:

Variant ID: vg0223737012 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23737012
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTCTTTCAAAACACTATAATAAAAATAAACATGCATTTATTTATTGTATATATTATAATAGAAAAATAAGGTCAAAGGTATATCTTGTAGAGTATGT[C/G,T]
ATTGTCCAAAGCGTCATTAAAATGAAACCGGAGATAGTAGATGGCAGATCTATTAATTTGGCCATCCTCGACATTGTCATCCATCCATGGTCCAAACTCC

Reverse complement sequence

GGAGTTTGGACCATGGATGGATGACAATGTCGAGGATGGCCAAATTAATAGATCTGCCATCTACTATCTCCGGTTTCATTTTAATGACGCTTTGGACAAT[G/C,A]
ACATACTCTACAAGATATACCTTTGACCTTATTTTTCTATTATAATATATACAATAAATAAATGCATGTTTATTTTTATTATAGTGTTTTGAAAGAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	27.80%	0.30%	0.00%	T: 0.02%
All Indica	2759	63.70%	35.90%	0.43%	0.00%	NA
All Japonica	1512	89.50%	10.40%	0.07%	0.00%	NA
Aus	269	56.90%	43.10%	0.00%	0.00%	NA
Indica I	595	60.00%	39.30%	0.67%	0.00%	NA
Indica II	465	83.00%	16.80%	0.22%	0.00%	NA
Indica III	913	44.90%	54.70%	0.44%	0.00%	NA
Indica Intermediate	786	76.80%	22.80%	0.38%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	70.40%	29.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	1.11%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223737012	C -> G	LOC_Os02g39300.1	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> G	LOC_Os02g39310.1	downstream_gene_variant ; 1238.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> G	LOC_Os02g39320.1	downstream_gene_variant ; 4825.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> G	LOC_Os02g39300-LOC_Os02g39310	intergenic_region ; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> T	LOC_Os02g39300.1	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> T	LOC_Os02g39310.1	downstream_gene_variant ; 1238.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> T	LOC_Os02g39320.1	downstream_gene_variant ; 4825.0bp to feature; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N
vg0223737012	C -> T	LOC_Os02g39300-LOC_Os02g39310	intergenic_region ; MODIFIER	silent_mutation	Average:54.589; most accessible tissue: Callus, score: 92.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223737012	NA	1.84E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	2.58E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	4.65E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	9.70E-07	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	5.20E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	5.72E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	8.24E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	7.77E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	3.47E-06	2.11E-09	mr1441	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	8.11E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	3.70E-06	4.88E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	2.16E-06	NA	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	1.68E-07	3.81E-09	mr1929	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	2.08E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	8.79E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	2.41E-06	NA	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	1.02E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	4.91E-06	3.96E-08	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	1.01E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	7.02E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	1.09E-08	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	NA	2.09E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223737012	2.65E-06	7.02E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251