\
| Variant ID: vg0223736839 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23736839 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 124. )
CCGTATTTAAGAGGCCCTGCATTTTTCAAGAAAATGGACCGCACTAATTTTTATGACCTCTGGTGCTATATTAATTAATGTTTTGAACAAGGTTGAGATT[A/T,G]
AACTTTTATAACTTTGACCATCATTAACTTTGAATATATTTAGTTTAAAGAAACTAGAAAAACATATATAGATTTTTCTTTCAAAACACTATAATAAAAA
TTTTTATTATAGTGTTTTGAAAGAAAAATCTATATATGTTTTTCTAGTTTCTTTAAACTAAATATATTCAAAGTTAATGATGGTCAAAGTTATAAAAGTT[T/A,C]
AATCTCAACCTTGTTCAAAACATTAATTAATATAGCACCAGAGGTCATAAAAATTAGTGCGGTCCATTTTCTTGAAAAATGCAGGGCCTCTTAAATACGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 19.00% | 1.46% | 0.00% | G: 0.08% |
| All Indica | 2759 | 67.20% | 30.70% | 2.07% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 96.80% | 2.60% | 0.60% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.10% | 44.40% | 5.55% | 0.00% | NA |
| Indica II | 465 | 69.70% | 29.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 77.40% | 22.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 66.90% | 30.80% | 2.16% | 0.00% | G: 0.13% |
| Temperate Japonica | 767 | 97.90% | 1.30% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 5.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 8.90% | 3.33% | 0.00% | G: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223736839 | A -> G | LOC_Os02g39300.1 | downstream_gene_variant ; 2442.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> G | LOC_Os02g39310.1 | downstream_gene_variant ; 1411.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> G | LOC_Os02g39320.1 | downstream_gene_variant ; 4998.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> G | LOC_Os02g39300-LOC_Os02g39310 | intergenic_region ; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> T | LOC_Os02g39300.1 | downstream_gene_variant ; 2442.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> T | LOC_Os02g39310.1 | downstream_gene_variant ; 1411.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> T | LOC_Os02g39320.1 | downstream_gene_variant ; 4998.0bp to feature; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0223736839 | A -> T | LOC_Os02g39300-LOC_Os02g39310 | intergenic_region ; MODIFIER | silent_mutation | Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223736839 | NA | 2.92E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223736839 | 1.79E-06 | 1.79E-06 | mr1444_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223736839 | 3.17E-06 | NA | mr1531_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223736839 | 3.57E-06 | 1.88E-07 | mr1531_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223736839 | NA | 5.60E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |