\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223736839:

Variant ID: vg0223736839 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23736839
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTATTTAAGAGGCCCTGCATTTTTCAAGAAAATGGACCGCACTAATTTTTATGACCTCTGGTGCTATATTAATTAATGTTTTGAACAAGGTTGAGATT[A/T,G]
AACTTTTATAACTTTGACCATCATTAACTTTGAATATATTTAGTTTAAAGAAACTAGAAAAACATATATAGATTTTTCTTTCAAAACACTATAATAAAAA

Reverse complement sequence

TTTTTATTATAGTGTTTTGAAAGAAAAATCTATATATGTTTTTCTAGTTTCTTTAAACTAAATATATTCAAAGTTAATGATGGTCAAAGTTATAAAAGTT[T/A,C]
AATCTCAACCTTGTTCAAAACATTAATTAATATAGCACCAGAGGTCATAAAAATTAGTGCGGTCCATTTTCTTGAAAAATGCAGGGCCTCTTAAATACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 19.00% 1.46% 0.00% G: 0.08%
All Indica  2759 67.20% 30.70% 2.07% 0.00% G: 0.04%
All Japonica  1512 96.80% 2.60% 0.60% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 50.10% 44.40% 5.55% 0.00% NA
Indica II  465 69.70% 29.70% 0.65% 0.00% NA
Indica III  913 77.40% 22.10% 0.44% 0.00% NA
Indica Intermediate  786 66.90% 30.80% 2.16% 0.00% G: 0.13%
Temperate Japonica  767 97.90% 1.30% 0.78% 0.00% NA
Tropical Japonica  504 93.80% 5.60% 0.60% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 8.90% 3.33% 0.00% G: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223736839 A -> G LOC_Os02g39300.1 downstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> G LOC_Os02g39310.1 downstream_gene_variant ; 1411.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> G LOC_Os02g39320.1 downstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> G LOC_Os02g39300-LOC_Os02g39310 intergenic_region ; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> T LOC_Os02g39300.1 downstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> T LOC_Os02g39310.1 downstream_gene_variant ; 1411.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> T LOC_Os02g39320.1 downstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0223736839 A -> T LOC_Os02g39300-LOC_Os02g39310 intergenic_region ; MODIFIER silent_mutation Average:45.192; most accessible tissue: Minghui63 root, score: 72.134 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223736839 NA 2.92E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839 1.79E-06 1.79E-06 mr1444_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839 3.17E-06 NA mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839 3.57E-06 1.88E-07 mr1531_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839 NA 5.60E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251