Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0223736839:

Variant ID: vg0223736839 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23736839
Reference Allele: A	Alternative Allele: T,G
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTATTTAAGAGGCCCTGCATTTTTCAAGAAAATGGACCGCACTAATTTTTATGACCTCTGGTGCTATATTAATTAATGTTTTGAACAAGGTTGAGATT[A/T,G]
AACTTTTATAACTTTGACCATCATTAACTTTGAATATATTTAGTTTAAAGAAACTAGAAAAACATATATAGATTTTTCTTTCAAAACACTATAATAAAAA

Reverse complement sequence

TTTTTATTATAGTGTTTTGAAAGAAAAATCTATATATGTTTTTCTAGTTTCTTTAAACTAAATATATTCAAAGTTAATGATGGTCAAAGTTATAAAAGTT[T/A,C]
AATCTCAACCTTGTTCAAAACATTAATTAATATAGCACCAGAGGTCATAAAAATTAGTGCGGTCCATTTTCTTGAAAAATGCAGGGCCTCTTAAATACGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.50%	19.00%	1.46%	0.00%	G: 0.08%
All Indica	2759	67.20%	30.70%	2.07%	0.00%	G: 0.04%
All Japonica	1512	96.80%	2.60%	0.60%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	50.10%	44.40%	5.55%	0.00%	NA
Indica II	465	69.70%	29.70%	0.65%	0.00%	NA
Indica III	913	77.40%	22.10%	0.44%	0.00%	NA
Indica Intermediate	786	66.90%	30.80%	2.16%	0.00%	G: 0.13%
Temperate Japonica	767	97.90%	1.30%	0.78%	0.00%	NA
Tropical Japonica	504	93.80%	5.60%	0.60%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	8.90%	3.33%	0.00%	G: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223736839	A -> G	LOC_Os02g39300.1	downstream_gene_variant ; 2442.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> G	LOC_Os02g39310.1	downstream_gene_variant ; 1411.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> G	LOC_Os02g39320.1	downstream_gene_variant ; 4998.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> G	LOC_Os02g39300-LOC_Os02g39310	intergenic_region ; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> T	LOC_Os02g39300.1	downstream_gene_variant ; 2442.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> T	LOC_Os02g39310.1	downstream_gene_variant ; 1411.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> T	LOC_Os02g39320.1	downstream_gene_variant ; 4998.0bp to feature; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N
vg0223736839	A -> T	LOC_Os02g39300-LOC_Os02g39310	intergenic_region ; MODIFIER	silent_mutation	Average:45.192; most accessible tissue: Minghui63 root, score: 72.134	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223736839	NA	2.92E-06	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839	1.79E-06	1.79E-06	mr1444_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839	3.17E-06	NA	mr1531_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839	3.57E-06	1.88E-07	mr1531_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736839	NA	5.60E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251