Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223736835:

Variant ID: vg0223736835 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23736835
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAACCGTATTTAAGAGGCCCTGCATTTTTCAAGAAAATGGACCGCACTAATTTTTATGACCTCTGGTGCTATATTAATTAATGTTTTGAACAAGGTTGA[G/A]
ATTAAACTTTTATAACTTTGACCATCATTAACTTTGAATATATTTAGTTTAAAGAAACTAGAAAAACATATATAGATTTTTCTTTCAAAACACTATAATA

Reverse complement sequence

TATTATAGTGTTTTGAAAGAAAAATCTATATATGTTTTTCTAGTTTCTTTAAACTAAATATATTCAAAGTTAATGATGGTCAAAGTTATAAAAGTTTAAT[C/T]
TCAACCTTGTTCAAAACATTAATTAATATAGCACCAGAGGTCATAAAAATTAGTGCGGTCCATTTTCTTGAAAAATGCAGGGCCTCTTAAATACGGTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 17.80% 0.25% 0.00% NA
All Indica  2759 70.60% 29.00% 0.40% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 85.90% 13.80% 0.37% 0.00% NA
Indica I  595 60.50% 38.80% 0.67% 0.00% NA
Indica II  465 84.50% 15.30% 0.22% 0.00% NA
Indica III  913 60.40% 39.40% 0.22% 0.00% NA
Indica Intermediate  786 81.90% 17.60% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223736835 G -> A LOC_Os02g39300.1 downstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:47.138; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0223736835 G -> A LOC_Os02g39310.1 downstream_gene_variant ; 1415.0bp to feature; MODIFIER silent_mutation Average:47.138; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0223736835 G -> A LOC_Os02g39300-LOC_Os02g39310 intergenic_region ; MODIFIER silent_mutation Average:47.138; most accessible tissue: Minghui63 root, score: 72.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223736835 NA 8.41E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 2.53E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 6.59E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 2.37E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 9.08E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 1.26E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 6.00E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 3.28E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 2.48E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 1.26E-06 NA mr1929 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 9.15E-07 5.88E-08 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 4.53E-06 NA mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 6.91E-06 NA mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 6.56E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 2.38E-06 NA mr1099_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 8.74E-06 NA mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 8.52E-08 NA mr1150_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 2.73E-06 7.97E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 2.13E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 NA 9.88E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 7.95E-06 NA mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223736835 3.18E-06 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251