\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223716736:

Variant ID: vg0223716736 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23716736
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCGCAAAGCAATGAGGTGTGAAAACGGTCACGAAAATTACCAACCAACCAAAGCTCATTTTTTTATTTCTACCAACCGAGTCATGTGAAAATGGTAAC[C/A,T]
GATGAAATTAAAAAAATATGCAAACAAAAATAGAAATGATTTCGCTGTTATATCGACTGTTTCTTTATCTTTATCTTACCGTATTCTTGCGAAAATTACC

Reverse complement sequence

GGTAATTTTCGCAAGAATACGGTAAGATAAAGATAAAGAAACAGTCGATATAACAGCGAAATCATTTCTATTTTTGTTTGCATATTTTTTTAATTTCATC[G/T,A]
GTTACCATTTTCACATGACTCGGTTGGTAGAAATAAAAAAATGAGCTTTGGTTGGTTGGTAATTTTCGTGACCGTTTTCACACCTCATTGCTTTGCGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 24.40% 0.02% 0.28% T: 0.06%
All Indica  2759 63.90% 35.60% 0.04% 0.40% T: 0.07%
All Japonica  1512 98.20% 1.70% 0.00% 0.07% T: 0.07%
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 60.30% 39.30% 0.00% 0.34% NA
Indica II  465 84.70% 14.80% 0.00% 0.43% NA
Indica III  913 44.50% 55.20% 0.11% 0.22% NA
Indica Intermediate  786 76.80% 22.30% 0.00% 0.64% T: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.20% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223716736 C -> A LOC_Os02g39280.1 upstream_gene_variant ; 3701.0bp to feature; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> A LOC_Os02g39260.1 downstream_gene_variant ; 4290.0bp to feature; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> A LOC_Os02g39260-LOC_Os02g39280 intergenic_region ; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> T LOC_Os02g39280.1 upstream_gene_variant ; 3701.0bp to feature; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> T LOC_Os02g39260.1 downstream_gene_variant ; 4290.0bp to feature; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> T LOC_Os02g39260-LOC_Os02g39280 intergenic_region ; MODIFIER silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N
vg0223716736 C -> DEL N N silent_mutation Average:78.273; most accessible tissue: Callus, score: 90.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223716736 1.83E-06 NA mr1074 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 2.20E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 2.11E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 4.29E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 1.60E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 2.16E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 3.23E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 1.60E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 NA 1.89E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223716736 1.93E-06 8.60E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251