\
| Variant ID: vg0223716736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23716736 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 232. )
ACCCGCAAAGCAATGAGGTGTGAAAACGGTCACGAAAATTACCAACCAACCAAAGCTCATTTTTTTATTTCTACCAACCGAGTCATGTGAAAATGGTAAC[C/A,T]
GATGAAATTAAAAAAATATGCAAACAAAAATAGAAATGATTTCGCTGTTATATCGACTGTTTCTTTATCTTTATCTTACCGTATTCTTGCGAAAATTACC
GGTAATTTTCGCAAGAATACGGTAAGATAAAGATAAAGAAACAGTCGATATAACAGCGAAATCATTTCTATTTTTGTTTGCATATTTTTTTAATTTCATC[G/T,A]
GTTACCATTTTCACATGACTCGGTTGGTAGAAATAAAAAAATGAGCTTTGGTTGGTTGGTAATTTTCGTGACCGTTTTCACACCTCATTGCTTTGCGGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 24.40% | 0.02% | 0.28% | T: 0.06% |
| All Indica | 2759 | 63.90% | 35.60% | 0.04% | 0.40% | T: 0.07% |
| All Japonica | 1512 | 98.20% | 1.70% | 0.00% | 0.07% | T: 0.07% |
| Aus | 269 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.30% | 39.30% | 0.00% | 0.34% | NA |
| Indica II | 465 | 84.70% | 14.80% | 0.00% | 0.43% | NA |
| Indica III | 913 | 44.50% | 55.20% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 76.80% | 22.30% | 0.00% | 0.64% | T: 0.25% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.20% | 0.00% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223716736 | C -> A | LOC_Os02g39280.1 | upstream_gene_variant ; 3701.0bp to feature; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> A | LOC_Os02g39260.1 | downstream_gene_variant ; 4290.0bp to feature; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> A | LOC_Os02g39260-LOC_Os02g39280 | intergenic_region ; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> T | LOC_Os02g39280.1 | upstream_gene_variant ; 3701.0bp to feature; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> T | LOC_Os02g39260.1 | downstream_gene_variant ; 4290.0bp to feature; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> T | LOC_Os02g39260-LOC_Os02g39280 | intergenic_region ; MODIFIER | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| vg0223716736 | C -> DEL | N | N | silent_mutation | Average:78.273; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223716736 | 1.83E-06 | NA | mr1074 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 2.20E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 2.11E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 4.29E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 1.60E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 2.16E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 3.23E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 1.60E-11 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | NA | 1.89E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223716736 | 1.93E-06 | 8.60E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |