\
| Variant ID: vg0223668140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23668140 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )
CGCCTATGCCTCTACCGCACTTCATCCTGCCAGAAAACCCTAACCCTAGTGCCGCCGACCAGTTGCGTATGGATCGGCGACCAGCCGCACGCGTGTCACG[C/T]
CCAGAAATTCACGAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGAACCAGCCAGGGTACACAAACGACAATTGTTGACATACAGATCC
GGATCTGTATGTCAACAATTGTCGTTTGTGTACCCTGGCTGGTTCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTCGTGAATTTCTGG[G/A]
CGTGACACGCGTGCGGCTGGTCGCCGATCCATACGCAACTGGTCGGCGGCACTAGGGTTAGGGTTTTCTGGCAGGATGAAGTGCGGTAGAGGCATAGGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 18.50% | 0.06% | 0.21% | NA |
| All Indica | 2759 | 72.20% | 27.40% | 0.11% | 0.29% | NA |
| All Japonica | 1512 | 98.20% | 1.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.20% | 14.40% | 0.22% | 0.22% | NA |
| Indica III | 913 | 58.90% | 40.50% | 0.22% | 0.33% | NA |
| Indica Intermediate | 786 | 80.00% | 19.50% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223668140 | C -> T | LOC_Os02g39170.1 | upstream_gene_variant ; 3681.0bp to feature; MODIFIER | silent_mutation | Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0223668140 | C -> T | LOC_Os02g39180.1 | downstream_gene_variant ; 977.0bp to feature; MODIFIER | silent_mutation | Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0223668140 | C -> T | LOC_Os02g39180-LOC_Os02g39190 | intergenic_region ; MODIFIER | silent_mutation | Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0223668140 | C -> DEL | N | N | silent_mutation | Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223668140 | NA | 8.68E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | NA | 4.44E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | NA | 6.31E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | 7.43E-07 | 1.40E-07 | mr1063_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | 1.13E-06 | NA | mr1161_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | 4.22E-06 | NA | mr1183_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223668140 | 2.32E-06 | 3.67E-07 | mr1183_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |