\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223668140:

Variant ID: vg0223668140 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23668140
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCTATGCCTCTACCGCACTTCATCCTGCCAGAAAACCCTAACCCTAGTGCCGCCGACCAGTTGCGTATGGATCGGCGACCAGCCGCACGCGTGTCACG[C/T]
CCAGAAATTCACGAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGAACCAGCCAGGGTACACAAACGACAATTGTTGACATACAGATCC

Reverse complement sequence

GGATCTGTATGTCAACAATTGTCGTTTGTGTACCCTGGCTGGTTCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTCGTGAATTTCTGG[G/A]
CGTGACACGCGTGCGGCTGGTCGCCGATCCATACGCAACTGGTCGGCGGCACTAGGGTTAGGGTTTTCTGGCAGGATGAAGTGCGGTAGAGGCATAGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 18.50% 0.06% 0.21% NA
All Indica  2759 72.20% 27.40% 0.11% 0.29% NA
All Japonica  1512 98.20% 1.70% 0.00% 0.07% NA
Aus  269 83.30% 16.70% 0.00% 0.00% NA
Indica I  595 71.90% 28.10% 0.00% 0.00% NA
Indica II  465 85.20% 14.40% 0.22% 0.22% NA
Indica III  913 58.90% 40.50% 0.22% 0.33% NA
Indica Intermediate  786 80.00% 19.50% 0.00% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.00% 0.41% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223668140 C -> T LOC_Os02g39170.1 upstream_gene_variant ; 3681.0bp to feature; MODIFIER silent_mutation Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0223668140 C -> T LOC_Os02g39180.1 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0223668140 C -> T LOC_Os02g39180-LOC_Os02g39190 intergenic_region ; MODIFIER silent_mutation Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0223668140 C -> DEL N N silent_mutation Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223668140 NA 8.68E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 NA 4.44E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 NA 6.31E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 7.43E-07 1.40E-07 mr1063_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 1.13E-06 NA mr1161_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 4.22E-06 NA mr1183_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140 2.32E-06 3.67E-07 mr1183_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251