RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0223641214:

Variant ID: vg0223641214 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23641214
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGATGATAATTCCATCTAAAATAGTCAGTAGATTGATTCAACTGAATATGTACAATAGAAGCACGCAATTCATGCCAATATACAAGATTCTGACCAA[C/T]
TAAAACTCTTCTAAAAGAAACATTAAGCGGAACAGATCCCATGGCATTAGCAATAGATAAATTTTTCCTTCGAACTATATAATATAAAGATGGATATTTA

Reverse complement sequence

TAAATATCCATCTTTATATTATATAGTTCGAAGGAAAAATTTATCTATTGCTAATGCCATGGGATCTGTTCCGCTTAATGTTTCTTTTAGAAGAGTTTTA[G/A]
TTGGTCAGAATCTTGTATATTGGCATGAATTGCGTGCTTCTATTGTACATATTCAGTTGAATCAATCTACTGACTATTTTAGATGGAATTATCATCAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	46.90%	0.15%	0.00%	NA
All Indica	2759	28.90%	71.00%	0.07%	0.00%	NA
All Japonica	1512	96.40%	3.60%	0.07%	0.00%	NA
Aus	269	37.20%	62.10%	0.74%	0.00%	NA
Indica I	595	12.40%	87.40%	0.17%	0.00%	NA
Indica II	465	46.20%	53.80%	0.00%	0.00%	NA
Indica III	913	22.10%	77.80%	0.11%	0.00%	NA
Indica Intermediate	786	39.10%	60.90%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	92.70%	7.10%	0.20%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223641214	C -> T	LOC_Os02g39140.1	upstream_gene_variant ; 1878.0bp to feature; MODIFIER	silent_mutation	Average:24.012; most accessible tissue: Callus, score: 34.16	N	N	N	N
vg0223641214	C -> T	LOC_Os02g39140.2	upstream_gene_variant ; 1878.0bp to feature; MODIFIER	silent_mutation	Average:24.012; most accessible tissue: Callus, score: 34.16	N	N	N	N
vg0223641214	C -> T	LOC_Os02g39130-LOC_Os02g39140	intergenic_region ; MODIFIER	silent_mutation	Average:24.012; most accessible tissue: Callus, score: 34.16	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223641214	NA	5.63E-18	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	1.28E-08	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	2.57E-07	1.37E-36	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	8.77E-06	5.11E-13	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	1.07E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	5.11E-06	1.19E-33	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	2.93E-10	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	2.58E-23	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	2.22E-09	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223641214	NA	2.31E-07	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 88 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0223641214:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact