Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223639154:

Variant ID: vg0223639154 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23639154
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTTAGGTGGTTATTAGTCTAGTATAAATAATTGAGAGTGCAAAATGTCTACGTGAGCCTTCACGTATACACACAATGTATACAAACTAACAAATAT[T/C]
ATTTTTTTAGAAAAATGTACATGTACTTTAAATAGTATTTATATATACGCGTGAAGTCCCATCTTTAAATTTATCATATATATATATGGAGAAAAAAATC

Reverse complement sequence

GATTTTTTTCTCCATATATATATATGATAAATTTAAAGATGGGACTTCACGCGTATATATAAATACTATTTAAAGTACATGTACATTTTTCTAAAAAAAT[A/G]
ATATTTGTTAGTTTGTATACATTGTGTGTATACGTGAAGGCTCACGTAGACATTTTGCACTCTCAATTATTTATACTAGACTAATAACCACCTAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	27.00%	3.43%	3.43%	NA
All Indica	2759	90.10%	9.40%	0.18%	0.25%	NA
All Japonica	1512	17.50%	64.50%	9.99%	8.07%	NA
Aus	269	98.50%	0.40%	0.00%	1.12%	NA
Indica I	595	94.50%	5.40%	0.17%	0.00%	NA
Indica II	465	97.60%	1.70%	0.00%	0.65%	NA
Indica III	913	88.90%	10.70%	0.00%	0.33%	NA
Indica Intermediate	786	83.80%	15.50%	0.51%	0.13%	NA
Temperate Japonica	767	2.10%	95.60%	1.83%	0.52%	NA
Tropical Japonica	504	44.20%	25.80%	15.08%	14.88%	NA
Japonica Intermediate	241	10.40%	46.50%	25.31%	17.84%	NA
VI/Aromatic	96	63.50%	11.50%	2.08%	22.92%	NA
Intermediate	90	54.40%	32.20%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223639154	T -> DEL	N	N	silent_mutation	Average:35.734; most accessible tissue: Callus, score: 63.527	N	N	N	N
vg0223639154	T -> C	LOC_Os02g39130.1	upstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:35.734; most accessible tissue: Callus, score: 63.527	N	N	N	N
vg0223639154	T -> C	LOC_Os02g39140.1	upstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:35.734; most accessible tissue: Callus, score: 63.527	N	N	N	N
vg0223639154	T -> C	LOC_Os02g39140.2	upstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:35.734; most accessible tissue: Callus, score: 63.527	N	N	N	N
vg0223639154	T -> C	LOC_Os02g39130-LOC_Os02g39140	intergenic_region ; MODIFIER	silent_mutation	Average:35.734; most accessible tissue: Callus, score: 63.527	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223639154	NA	4.56E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.85E-30	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.13E-31	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.61E-43	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.87E-32	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.44E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.69E-17	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	9.14E-27	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.41E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.51E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.56E-07	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.13E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	5.96E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	9.54E-19	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	5.86E-08	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.74E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.58E-35	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	4.19E-07	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	7.04E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	1.21E-06	2.61E-07	mr1182_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	6.36E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	6.62E-15	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.13E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.15E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	5.98E-06	mr1239_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.45E-14	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.55E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.66E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	1.35E-06	1.35E-06	mr1282_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	9.15E-06	9.15E-06	mr1569_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	8.48E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	4.30E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.13E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.16E-18	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	8.98E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.28E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.04E-17	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	7.61E-06	mr1866_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.34E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	6.80E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.86E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	1.46E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.98E-06	mr1929_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	6.51E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	2.38E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223639154	NA	3.42E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251