\
| Variant ID: vg0223638971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23638971 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )
ACCACTCCGCCGTTGGCCGCACGAGCGTGCGCACGAGGAAGAGAGAGTAGGGTGACCGGGGAGGCGTTAGATTGAGGGAGAAGTATGACAAGTGGGCCCA[C/T]
GGAGTTTTTTTAAAACTTTTTTGCTGACTGGACTGACACGTTGGCATCTCGTAGGTAAGCTCAAGTCAAAACCGCTAAGAACAATATTTAGGTGGTTATT
AATAACCACCTAAATATTGTTCTTAGCGGTTTTGACTTGAGCTTACCTACGAGATGCCAACGTGTCAGTCCAGTCAGCAAAAAAGTTTTAAAAAAACTCC[G/A]
TGGGCCCACTTGTCATACTTCTCCCTCAATCTAACGCCTCCCCGGTCACCCTACTCTCTCTTCCTCGTGCGCACGCTCGTGCGGCCAACGGCGGAGTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 25.90% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 76.20% | 23.30% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 68.40% | 30.60% | 1.06% | 0.00% | NA |
| Aus | 269 | 66.90% | 32.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.40% | 31.40% | 1.18% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.50% | 24.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 73.30% | 26.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 89.00% | 9.40% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 48.80% | 51.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.60% | 55.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223638971 | C -> T | LOC_Os02g39130.1 | upstream_gene_variant ; 3283.0bp to feature; MODIFIER | silent_mutation | Average:63.798; most accessible tissue: Callus, score: 87.421 | N | N | N | N |
| vg0223638971 | C -> T | LOC_Os02g39140.1 | upstream_gene_variant ; 4121.0bp to feature; MODIFIER | silent_mutation | Average:63.798; most accessible tissue: Callus, score: 87.421 | N | N | N | N |
| vg0223638971 | C -> T | LOC_Os02g39140.2 | upstream_gene_variant ; 4121.0bp to feature; MODIFIER | silent_mutation | Average:63.798; most accessible tissue: Callus, score: 87.421 | N | N | N | N |
| vg0223638971 | C -> T | LOC_Os02g39130-LOC_Os02g39140 | intergenic_region ; MODIFIER | silent_mutation | Average:63.798; most accessible tissue: Callus, score: 87.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223638971 | 8.20E-06 | 8.19E-06 | mr1340 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 4.51E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 5.11E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 1.67E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 2.73E-06 | mr1364_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 2.87E-07 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 1.06E-06 | mr1771_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 8.64E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | 1.14E-06 | 1.14E-06 | mr1906_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 7.48E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223638971 | NA | 1.58E-07 | mr1960_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |