\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223638971:

Variant ID: vg0223638971 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23638971
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACTCCGCCGTTGGCCGCACGAGCGTGCGCACGAGGAAGAGAGAGTAGGGTGACCGGGGAGGCGTTAGATTGAGGGAGAAGTATGACAAGTGGGCCCA[C/T]
GGAGTTTTTTTAAAACTTTTTTGCTGACTGGACTGACACGTTGGCATCTCGTAGGTAAGCTCAAGTCAAAACCGCTAAGAACAATATTTAGGTGGTTATT

Reverse complement sequence

AATAACCACCTAAATATTGTTCTTAGCGGTTTTGACTTGAGCTTACCTACGAGATGCCAACGTGTCAGTCCAGTCAGCAAAAAAGTTTTAAAAAAACTCC[G/A]
TGGGCCCACTTGTCATACTTCTCCCTCAATCTAACGCCTCCCCGGTCACCCTACTCTCTCTTCCTCGTGCGCACGCTCGTGCGGCCAACGGCGGAGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 25.90% 0.70% 0.00% NA
All Indica  2759 76.20% 23.30% 0.54% 0.00% NA
All Japonica  1512 68.40% 30.60% 1.06% 0.00% NA
Aus  269 66.90% 32.70% 0.37% 0.00% NA
Indica I  595 67.40% 31.40% 1.18% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 75.50% 24.30% 0.22% 0.00% NA
Indica Intermediate  786 73.30% 26.00% 0.76% 0.00% NA
Temperate Japonica  767 89.00% 9.40% 1.56% 0.00% NA
Tropical Japonica  504 48.80% 51.00% 0.20% 0.00% NA
Japonica Intermediate  241 43.60% 55.20% 1.24% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223638971 C -> T LOC_Os02g39130.1 upstream_gene_variant ; 3283.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 87.421 N N N N
vg0223638971 C -> T LOC_Os02g39140.1 upstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 87.421 N N N N
vg0223638971 C -> T LOC_Os02g39140.2 upstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 87.421 N N N N
vg0223638971 C -> T LOC_Os02g39130-LOC_Os02g39140 intergenic_region ; MODIFIER silent_mutation Average:63.798; most accessible tissue: Callus, score: 87.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223638971 8.20E-06 8.19E-06 mr1340 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 4.51E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 5.11E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 1.67E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 2.73E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 2.87E-07 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 1.06E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 8.64E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 1.14E-06 1.14E-06 mr1906_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 7.48E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971 NA 1.58E-07 mr1960_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251