\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223634166:

Variant ID: vg0223634166 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23634166
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAAGGACTAAAAAATGCCTCCAACTCCAGCAGTAGCCCCTATTTCTTAGTCCCTACTCATGTTTATCTTGTATTTTAAAATACAATCCATATACAGTA[T/C]
GTTTAACACCACAAAAATTCGAACACAATTATTTCTAACTCACATAATTTAACCATACTTAAATTCACAATTTCAAACACTACAATTCGAATACAAAATT

Reverse complement sequence

AATTTTGTATTCGAATTGTAGTGTTTGAAATTGTGAATTTAAGTATGGTTAAATTATGTGAGTTAGAAATAATTGTGTTCGAATTTTTGTGGTGTTAAAC[A/G]
TACTGTATATGGATTGTATTTTAAAATACAAGATAAACATGAGTAGGGACTAAGAAATAGGGGCTACTGCTGGAGTTGGAGGCATTTTTTAGTCCTTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 34.40% 2.03% 3.77% NA
All Indica  2759 86.70% 12.50% 0.43% 0.33% NA
All Japonica  1512 4.90% 81.50% 3.31% 10.25% NA
Aus  269 98.10% 0.70% 0.74% 0.37% NA
Indica I  595 87.40% 12.40% 0.17% 0.00% NA
Indica II  465 97.00% 1.70% 0.86% 0.43% NA
Indica III  913 86.10% 13.30% 0.22% 0.44% NA
Indica Intermediate  786 80.90% 18.10% 0.64% 0.38% NA
Temperate Japonica  767 1.60% 97.90% 0.13% 0.39% NA
Tropical Japonica  504 9.90% 53.20% 8.73% 28.17% NA
Japonica Intermediate  241 5.00% 88.80% 2.07% 4.15% NA
VI/Aromatic  96 56.20% 10.40% 26.04% 7.29% NA
Intermediate  90 44.40% 41.10% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223634166 T -> DEL N N silent_mutation Average:39.102; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0223634166 T -> C LOC_Os02g39130.1 downstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:39.102; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0223634166 T -> C LOC_Os02g39120-LOC_Os02g39130 intergenic_region ; MODIFIER silent_mutation Average:39.102; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223634166 NA 1.54E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 3.02E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 4.41E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 7.46E-06 NA mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.14E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 9.46E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 6.84E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 5.92E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 7.77E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 3.52E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.37E-06 mr1622_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 7.64E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 9.62E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 7.82E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 1.42E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.48E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.55E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.37E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 3.08E-06 mr1756_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 3.13E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.98E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 2.21E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223634166 NA 1.39E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251