\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223629300:

Variant ID: vg0223629300 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23629300
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTAGATAAAAAGAGGACTTTTGGACACAAGCCCTTGGCCAGATCCGATCCCAGAGCGATTGGGGGCTGGTTGACACTTTGTTACTTGTTCATACACA[A/G]
ATCCACCAAAACACAAGAGTAGGGTATTACGCTTCCCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTCGCGTTTCTTCCTAGCTGGCGATCTTTCCA

Reverse complement sequence

TGGAAAGATCGCCAGCTAGGAAGAAACGCGAGACACGGGCGATGTATACAGGTTCGGGCCGCTGGGAAGCGTAATACCCTACTCTTGTGTTTTGGTGGAT[T/C]
TGTGTATGAACAAGTAACAAAGTGTCAACCAGCCCCCAATCGCTCTGGGATCGGATCTGGCCAAGGGCTTGTGTCCAAAAGTCCTCTTTTTATCTAAGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.90% 0.10% 19.11% 63.90% NA
All Indica  2759 2.10% 0.20% 14.24% 83.44% NA
All Japonica  1512 47.80% 0.00% 24.40% 27.78% NA
Aus  269 0.40% 0.00% 39.41% 60.22% NA
Indica I  595 3.20% 0.00% 3.19% 93.61% NA
Indica II  465 0.90% 0.20% 9.68% 89.25% NA
Indica III  913 0.20% 0.40% 20.48% 78.86% NA
Indica Intermediate  786 4.30% 0.00% 18.07% 77.61% NA
Temperate Japonica  767 82.80% 0.00% 6.52% 10.69% NA
Tropical Japonica  504 2.80% 0.00% 48.02% 49.21% NA
Japonica Intermediate  241 30.70% 0.00% 31.95% 37.34% NA
VI/Aromatic  96 0.00% 0.00% 17.71% 82.29% NA
Intermediate  90 16.70% 0.00% 20.00% 63.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223629300 A -> G LOC_Os02g39120.1 upstream_gene_variant ; 1501.0bp to feature; MODIFIER silent_mutation Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0223629300 A -> G LOC_Os02g39120-LOC_Os02g39130 intergenic_region ; MODIFIER silent_mutation Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0223629300 A -> DEL N N silent_mutation Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223629300 NA 7.16E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 2.05E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 7.94E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 3.44E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 3.54E-06 3.54E-06 mr1827 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 6.75E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 9.53E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 2.58E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 7.45E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 4.54E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.85E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 7.94E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 3.67E-15 mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 3.26E-06 1.21E-57 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 5.84E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 3.98E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 5.47E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 4.43E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 2.18E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.24E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.70E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.03E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.65E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 7.19E-28 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.14E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.12E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.49E-19 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 2.80E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 7.22E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 6.78E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 6.92E-18 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 9.28E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 3.11E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 6.29E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 5.10E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223629300 NA 1.01E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251