\
| Variant ID: vg0223629300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23629300 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CACTTAGATAAAAAGAGGACTTTTGGACACAAGCCCTTGGCCAGATCCGATCCCAGAGCGATTGGGGGCTGGTTGACACTTTGTTACTTGTTCATACACA[A/G]
ATCCACCAAAACACAAGAGTAGGGTATTACGCTTCCCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTCGCGTTTCTTCCTAGCTGGCGATCTTTCCA
TGGAAAGATCGCCAGCTAGGAAGAAACGCGAGACACGGGCGATGTATACAGGTTCGGGCCGCTGGGAAGCGTAATACCCTACTCTTGTGTTTTGGTGGAT[T/C]
TGTGTATGAACAAGTAACAAAGTGTCAACCAGCCCCCAATCGCTCTGGGATCGGATCTGGCCAAGGGCTTGTGTCCAAAAGTCCTCTTTTTATCTAAGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 16.90% | 0.10% | 19.11% | 63.90% | NA |
| All Indica | 2759 | 2.10% | 0.20% | 14.24% | 83.44% | NA |
| All Japonica | 1512 | 47.80% | 0.00% | 24.40% | 27.78% | NA |
| Aus | 269 | 0.40% | 0.00% | 39.41% | 60.22% | NA |
| Indica I | 595 | 3.20% | 0.00% | 3.19% | 93.61% | NA |
| Indica II | 465 | 0.90% | 0.20% | 9.68% | 89.25% | NA |
| Indica III | 913 | 0.20% | 0.40% | 20.48% | 78.86% | NA |
| Indica Intermediate | 786 | 4.30% | 0.00% | 18.07% | 77.61% | NA |
| Temperate Japonica | 767 | 82.80% | 0.00% | 6.52% | 10.69% | NA |
| Tropical Japonica | 504 | 2.80% | 0.00% | 48.02% | 49.21% | NA |
| Japonica Intermediate | 241 | 30.70% | 0.00% | 31.95% | 37.34% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 17.71% | 82.29% | NA |
| Intermediate | 90 | 16.70% | 0.00% | 20.00% | 63.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223629300 | A -> G | LOC_Os02g39120.1 | upstream_gene_variant ; 1501.0bp to feature; MODIFIER | silent_mutation | Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0223629300 | A -> G | LOC_Os02g39120-LOC_Os02g39130 | intergenic_region ; MODIFIER | silent_mutation | Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0223629300 | A -> DEL | N | N | silent_mutation | Average:6.2; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223629300 | NA | 7.16E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 2.05E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 7.94E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 3.44E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | 3.54E-06 | 3.54E-06 | mr1827 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 6.75E-18 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 9.53E-32 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 2.58E-07 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 7.45E-14 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 4.54E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.85E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 7.94E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 3.67E-15 | mr1258_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | 3.26E-06 | 1.21E-57 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 5.84E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 3.98E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 5.47E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 4.43E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 2.18E-22 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.24E-15 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.70E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.03E-27 | mr1584_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.65E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 7.19E-28 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.14E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.12E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.49E-19 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 2.80E-20 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 7.22E-12 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 6.78E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 6.92E-18 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 9.28E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 3.11E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 6.29E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 5.10E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223629300 | NA | 1.01E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |