\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223615815:

Variant ID: vg0223615815 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 23615815
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGAAAGATTGACGGATGGTGCTAGGGGCACGACCTAGGGGCACCCGTTGTAGATGGCCTCATACTACTGGATACTTCCTCCGTTATAGGGGTGGGTA[GA/AA,G]
AAAAGACCGAGATCGATAAATGCGGTCATCAATTTGGTCCTAGGCAGGGAAATACCAAATTTTGTTCAGTCAATTGTTAGTCTCCTCGGTTAAATGAATA

Reverse complement sequence

TATTCATTTAACCGAGGAGACTAACAATTGACTGAACAAAATTTGGTATTTCCCTGCCTAGGACCAAATTGATGACCGCATTTATCGATCTCGGTCTTTT[TC/TT,C]
TACCCACCCCTATAACGGAGGAAGTATCCAGTAGTATGAGGCCATCTACAACGGGTGCCCCTAGGTCGTGCCCCTAGCACCATCCGTCAATCTTTCCATC

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.40% 0.11% 0.00% G: 0.02%
All Indica  2759 90.70% 9.20% 0.07% 0.00% G: 0.04%
All Japonica  1512 64.40% 35.40% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 87.80% 11.90% 0.11% 0.00% G: 0.11%
Indica Intermediate  786 85.10% 14.80% 0.13% 0.00% NA
Temperate Japonica  767 82.80% 17.20% 0.00% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 58.90% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223615815 GA -> G LOC_Os02g39100.1 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0223615815 GA -> G LOC_Os02g39110.1 upstream_gene_variant ; 1930.0bp to feature; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0223615815 GA -> G LOC_Os02g39100-LOC_Os02g39110 intergenic_region ; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0223615815 GA -> AA LOC_Os02g39100.1 upstream_gene_variant ; 1296.0bp to feature; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0223615815 GA -> AA LOC_Os02g39110.1 upstream_gene_variant ; 1931.0bp to feature; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0223615815 GA -> AA LOC_Os02g39100-LOC_Os02g39110 intergenic_region ; MODIFIER silent_mutation Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223615815 NA 1.89E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 1.68E-07 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 3.27E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 1.32E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 6.28E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 1.00E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 3.19E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 2.73E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 2.32E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 4.31E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223615815 NA 2.47E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251