| Variant ID: vg0223615815 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 23615815 |
| Reference Allele: GA | Alternative Allele: AA,G |
| Primary Allele: GA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
GATGGAAAGATTGACGGATGGTGCTAGGGGCACGACCTAGGGGCACCCGTTGTAGATGGCCTCATACTACTGGATACTTCCTCCGTTATAGGGGTGGGTA[GA/AA,G]
AAAAGACCGAGATCGATAAATGCGGTCATCAATTTGGTCCTAGGCAGGGAAATACCAAATTTTGTTCAGTCAATTGTTAGTCTCCTCGGTTAAATGAATA
TATTCATTTAACCGAGGAGACTAACAATTGACTGAACAAAATTTGGTATTTCCCTGCCTAGGACCAAATTGATGACCGCATTTATCGATCTCGGTCTTTT[TC/TT,C]
TACCCACCCCTATAACGGAGGAAGTATCCAGTAGTATGAGGCCATCTACAACGGGTGCCCCTAGGTCGTGCCCCTAGCACCATCCGTCAATCTTTCCATC
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 17.40% | 0.11% | 0.00% | G: 0.02% |
| All Indica | 2759 | 90.70% | 9.20% | 0.07% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 64.40% | 35.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.80% | 11.90% | 0.11% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 85.10% | 14.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 40.20% | 58.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223615815 | GA -> G | LOC_Os02g39100.1 | upstream_gene_variant ; 1297.0bp to feature; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0223615815 | GA -> G | LOC_Os02g39110.1 | upstream_gene_variant ; 1930.0bp to feature; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0223615815 | GA -> G | LOC_Os02g39100-LOC_Os02g39110 | intergenic_region ; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0223615815 | GA -> AA | LOC_Os02g39100.1 | upstream_gene_variant ; 1296.0bp to feature; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0223615815 | GA -> AA | LOC_Os02g39110.1 | upstream_gene_variant ; 1931.0bp to feature; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0223615815 | GA -> AA | LOC_Os02g39100-LOC_Os02g39110 | intergenic_region ; MODIFIER | silent_mutation | Average:66.87; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223615815 | NA | 1.89E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | 1.68E-07 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 3.27E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 1.32E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 6.28E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 1.00E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 3.19E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 2.73E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 2.32E-06 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 4.31E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223615815 | NA | 2.47E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |