\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223611192:

Variant ID: vg0223611192 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23611192
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.17, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTCTAGGCTCGCCATTGTAGTGGCATATCAATCTGAATCCCCTGAAACGCAACTCACGTGCAAAGTCCTAGTACTTTCTTTCTCTGTAGCTCATCAC[A/G]
TTCACATCGCTAGATTGGATTGGAACCCTATATACTGTTCATGACAGATTGCGTGTACTACCAAAAAAAAGATCCAGTAAAAACATAGATATTTCAGTGG

Reverse complement sequence

CCACTGAAATATCTATGTTTTTACTGGATCTTTTTTTTGGTAGTACACGCAATCTGTCATGAACAGTATATAGGGTTCCAATCCAATCTAGCGATGTGAA[T/C]
GTGATGAGCTACAGAGAAAGAAAGTACTAGGACTTTGCACGTGAGTTGCGTTTCAGGGGATTCAGATTGATATGCCACTACAATGGCGAGCCTAGAGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.90% 0.19% 0.00% NA
All Indica  2759 80.50% 19.30% 0.25% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.07% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 94.60% 5.00% 0.34% 0.00% NA
Indica II  465 72.00% 27.70% 0.22% 0.00% NA
Indica III  913 84.70% 15.20% 0.11% 0.00% NA
Indica Intermediate  786 69.80% 29.80% 0.38% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223611192 A -> G LOC_Os02g39090.1 upstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:81.484; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N
vg0223611192 A -> G LOC_Os02g39080.1 downstream_gene_variant ; 3542.0bp to feature; MODIFIER silent_mutation Average:81.484; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N
vg0223611192 A -> G LOC_Os02g39100.1 downstream_gene_variant ; 810.0bp to feature; MODIFIER silent_mutation Average:81.484; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N
vg0223611192 A -> G LOC_Os02g39090-LOC_Os02g39100 intergenic_region ; MODIFIER silent_mutation Average:81.484; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223611192 A G 0.08 0.04 0.04 0.04 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223611192 NA 2.73E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 4.75E-06 mr1402 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 2.65E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 5.17E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 1.62E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 1.64E-07 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 7.37E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 8.81E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 3.07E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 4.39E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 5.51E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 1.15E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 3.65E-07 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 9.75E-07 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 2.58E-06 9.89E-06 mr1594_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 9.11E-08 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 6.86E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223611192 NA 1.54E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251