Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223583301:

Variant ID: vg0223583301 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23583301
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTACTAACAACATAGGCATTTTCTTTCTCAAAATAAGGAATAACATGTGTGTTTTACAACAATAAATCTCATGGTTAACAAACTACAGTAGAAATAAA[G/T]
ATCAAAGTGTGGTTTTGTGAGGTGTTTTAAGTTTCTAGAGACAACTTAGAATTGGTGACCGAATGCATGTCTATTGTCTAATATAGCATCCTGGACTCCT

Reverse complement sequence

AGGAGTCCAGGATGCTATATTAGACAATAGACATGCATTCGGTCACCAATTCTAAGTTGTCTCTAGAAACTTAAAACACCTCACAAAACCACACTTTGAT[C/A]
TTTATTTCTACTGTAGTTTGTTAACCATGAGATTTATTGTTGTAAAACACACATGTTATTCCTTATTTTGAGAAAGAAAATGCCTATGTTGTTAGTACCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	7.90%	0.63%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.04%	0.00%	NA
All Japonica	1512	79.20%	19.00%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	8.10%	0.00%	0.00%	NA
Temperate Japonica	767	90.10%	7.70%	2.22%	0.00%	NA
Tropical Japonica	504	76.40%	23.00%	0.60%	0.00%	NA
Japonica Intermediate	241	50.60%	46.90%	2.49%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	90.00%	7.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223583301	G -> T	LOC_Os02g39050.1	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:60.957; most accessible tissue: Callus, score: 84.091	N	N	N	N
vg0223583301	G -> T	LOC_Os02g39064.1	downstream_gene_variant ; 1993.0bp to feature; MODIFIER	silent_mutation	Average:60.957; most accessible tissue: Callus, score: 84.091	N	N	N	N
vg0223583301	G -> T	LOC_Os02g39060.1	intron_variant ; MODIFIER	silent_mutation	Average:60.957; most accessible tissue: Callus, score: 84.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223583301	NA	2.65E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	8.75E-06	8.75E-06	mr1284_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	8.87E-06	8.87E-06	mr1412_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.98E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.13E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	5.19E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	5.92E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	3.37E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	9.91E-06	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.85E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	5.49E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.77E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	3.99E-06	3.99E-06	mr1747_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	9.83E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.05E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	2.58E-06	mr1779_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	9.99E-06	mr1976_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301	NA	1.48E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251