\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223583301:

Variant ID: vg0223583301 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23583301
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTACTAACAACATAGGCATTTTCTTTCTCAAAATAAGGAATAACATGTGTGTTTTACAACAATAAATCTCATGGTTAACAAACTACAGTAGAAATAAA[G/T]
ATCAAAGTGTGGTTTTGTGAGGTGTTTTAAGTTTCTAGAGACAACTTAGAATTGGTGACCGAATGCATGTCTATTGTCTAATATAGCATCCTGGACTCCT

Reverse complement sequence

AGGAGTCCAGGATGCTATATTAGACAATAGACATGCATTCGGTCACCAATTCTAAGTTGTCTCTAGAAACTTAAAACACCTCACAAAACCACACTTTGAT[C/A]
TTTATTTCTACTGTAGTTTGTTAACCATGAGATTTATTGTTGTAAAACACACATGTTATTCCTTATTTTGAGAAAGAAAATGCCTATGTTGTTAGTACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.90% 0.63% 0.00% NA
All Indica  2759 97.20% 2.80% 0.04% 0.00% NA
All Japonica  1512 79.20% 19.00% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 8.10% 0.00% 0.00% NA
Temperate Japonica  767 90.10% 7.70% 2.22% 0.00% NA
Tropical Japonica  504 76.40% 23.00% 0.60% 0.00% NA
Japonica Intermediate  241 50.60% 46.90% 2.49% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223583301 G -> T LOC_Os02g39050.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:60.957; most accessible tissue: Callus, score: 84.091 N N N N
vg0223583301 G -> T LOC_Os02g39064.1 downstream_gene_variant ; 1993.0bp to feature; MODIFIER silent_mutation Average:60.957; most accessible tissue: Callus, score: 84.091 N N N N
vg0223583301 G -> T LOC_Os02g39060.1 intron_variant ; MODIFIER silent_mutation Average:60.957; most accessible tissue: Callus, score: 84.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223583301 NA 2.65E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 8.75E-06 8.75E-06 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 8.87E-06 8.87E-06 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.98E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.13E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 5.19E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 5.92E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 3.37E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 9.91E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.85E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 5.49E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.77E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 3.99E-06 3.99E-06 mr1747_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 9.83E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.05E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 2.58E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 9.99E-06 mr1976_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223583301 NA 1.48E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251