Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223574312:

Variant ID: vg0223574312 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23574312
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGGTGGCCATCAAA[C/G]
AAGGCACAGGTTAGTAATCTGCAGTCTTTTCTTATTGACAATGAAAAACGAAATATCCTTGTGAGTGGTATCTTGACTCTTAAAGTCTTAATTGGCATTT

Reverse complement sequence

AAATGCCAATTAAGACTTTAAGAGTCAAGATACCACTCACAAGGATATTTCGTTTTTCATTGTCAATAAGAAAAGACTGCAGATTACTAACCTGTGCCTT[G/C]
TTTGATGGCCACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 4.70% 13.97% 4.32% NA
All Indica  2759 62.90% 7.60% 22.33% 7.21% NA
All Japonica  1512 97.90% 0.30% 1.52% 0.20% NA
Aus  269 94.80% 1.90% 2.97% 0.37% NA
Indica I  595 64.50% 3.40% 27.39% 4.71% NA
Indica II  465 61.10% 7.50% 22.15% 9.25% NA
Indica III  913 63.10% 9.60% 18.95% 8.32% NA
Indica Intermediate  786 62.50% 8.40% 22.52% 6.62% NA
Temperate Japonica  767 99.20% 0.10% 0.65% 0.00% NA
Tropical Japonica  504 95.40% 0.80% 3.17% 0.60% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 83.30% 2.20% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223574312 C -> G LOC_Os02g39030.1 missense_variant ; p.Gln144Glu; MODERATE nonsynonymous_codon ; Q144E Average:69.161; most accessible tissue: Zhenshan97 flag leaf, score: 91.934 unknown unknown TOLERATED 0.41
vg0223574312 C -> G LOC_Os02g39030.2 missense_variant ; p.Gln144Glu; MODERATE nonsynonymous_codon ; Q144E Average:69.161; most accessible tissue: Zhenshan97 flag leaf, score: 91.934 unknown unknown TOLERATED 0.41
vg0223574312 C -> DEL LOC_Os02g39030.1 N frameshift_variant Average:69.161; most accessible tissue: Zhenshan97 flag leaf, score: 91.934 N N N N
vg0223574312 C -> DEL LOC_Os02g39030.2 N frameshift_variant Average:69.161; most accessible tissue: Zhenshan97 flag leaf, score: 91.934 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223574312 C G 0.0 -0.01 -0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223574312 NA 7.14E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223574312 NA 1.53E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223574312 3.93E-06 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223574312 3.78E-06 1.17E-11 mr1746_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223574312 NA 9.94E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251