Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223526274:

Variant ID: vg0223526274 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23526274
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGGCCCAATAATGTGCACTCTGCTGCATTCCCCTTTGGAGAAGGTTGGATCAGATGTAGTATAGGGTGTGTTTATTTCACGCTAAAATTGAAAGTTT[G/A]
GTTGAAATTGAAACGATGTGATAGAAAAGTTGAAAGTTTATGTGTGTAGGAAAGTTTTGATATGATGAAAAAATTAAAAGTTTAAAAAAAAATTTGTAAC

Reverse complement sequence

GTTACAAATTTTTTTTTAAACTTTTAATTTTTTCATCATATCAAAACTTTCCTACACACATAAACTTTCAACTTTTCTATCACATCGTTTCAATTTCAAC[C/T]
AAACTTTCAATTTTAGCGTGAAATAAACACACCCTATACTACATCTGATCCAACCTTCTCCAAAGGGGAATGCAGCAGAGTGCACATTATTGGGCCACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.60% 0.23% 0.00% NA
All Indica  2759 74.70% 25.00% 0.33% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 70.60% 28.60% 0.84% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 65.20% 34.60% 0.22% 0.00% NA
Indica Intermediate  786 83.20% 16.50% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223526274 G -> A LOC_Os02g38920.1 upstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:88.555; most accessible tissue: Callus, score: 98.332 N N N N
vg0223526274 G -> A LOC_Os02g38910-LOC_Os02g38920 intergenic_region ; MODIFIER silent_mutation Average:88.555; most accessible tissue: Callus, score: 98.332 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223526274 G A 0.01 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223526274 NA 1.48E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 3.13E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 7.36E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 8.71E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 3.85E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 6.87E-06 NA mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 2.72E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 2.33E-06 NA mr1124_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 3.38E-07 NA mr1124_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223526274 NA 1.26E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251