\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223522948:

Variant ID: vg0223522948 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23522948
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.31, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTATGTTCAGATTTGTTATACTAGAATATATCACATTCTATTATGAGGTTGATTTTTTAGGTGGCTTATACTCCCTCCATCCTTGCAGTTGTGGGTTTCT[G/A]
TGTATAGCGTTTAACCGTCCTTCTTATTTGAAATTTTTGTAATTAATATTTTTATTGTTATTAGACGATAAAAATACTTTATGTGTTTTTCAAATAAGAC

Reverse complement sequence

GTCTTATTTGAAAAACACATAAAGTATTTTTATCGTCTAATAACAATAAAAATATTAATTACAAAAATTTCAAATAAGAAGGACGGTTAAACGCTATACA[C/T]
AGAAACCCACAACTGCAAGGATGGAGGGAGTATAAGCCACCTAAAAAATCAACCTCATAATAGAATGTGATATATTCTAGTATAACAAATCTGAACATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.00% 0.32% 0.78% NA
All Indica  2759 69.30% 30.40% 0.29% 0.04% NA
All Japonica  1512 64.30% 35.40% 0.07% 0.20% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 89.10% 10.80% 0.17% 0.00% NA
Indica II  465 69.50% 29.70% 0.65% 0.22% NA
Indica III  913 60.60% 39.30% 0.11% 0.00% NA
Indica Intermediate  786 64.40% 35.20% 0.38% 0.00% NA
Temperate Japonica  767 78.50% 21.50% 0.00% 0.00% NA
Tropical Japonica  504 54.60% 45.40% 0.00% 0.00% NA
Japonica Intermediate  241 39.40% 58.90% 0.41% 1.24% NA
VI/Aromatic  96 52.10% 14.60% 4.17% 29.17% NA
Intermediate  90 64.40% 30.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223522948 G -> A LOC_Os02g38910.1 upstream_gene_variant ; 2397.0bp to feature; MODIFIER silent_mutation Average:64.351; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0223522948 G -> A LOC_Os02g38920.1 upstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:64.351; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0223522948 G -> A LOC_Os02g38910-LOC_Os02g38920 intergenic_region ; MODIFIER silent_mutation Average:64.351; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0223522948 G -> DEL N N silent_mutation Average:64.351; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223522948 NA 7.43E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 9.56E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 4.31E-06 mr1847 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 6.78E-06 6.78E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 2.72E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.76E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 7.46E-06 7.45E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 2.28E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.13E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.13E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 3.57E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.67E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 9.60E-06 9.60E-06 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 3.05E-06 3.05E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 2.26E-06 2.26E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.90E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 9.34E-07 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 3.54E-07 3.53E-07 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 1.30E-06 1.30E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 7.81E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.05E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 6.03E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.75E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 5.72E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 2.02E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 3.42E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 9.07E-07 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 2.68E-06 2.68E-06 mr1831_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.04E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 1.05E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 NA 3.60E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522948 2.76E-06 2.76E-06 mr1984_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251