\
| Variant ID: vg0223522704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23522704 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCTTGAGAGACAGGACATTGGGAGTCGGAGAGGAGCACTTGCTTTCCCTCAAATCAACATAGCGATAAATATGGGGAACTCCAAAACATGTGCAAGGCTA[G/C]
GGATCATTGGATCCGATTTTTCACCTAAAAGCCCTCAAAATCAGATTTGGGAAGAATATAAGAGAAAGGTTGGTGATGCTCTTATTCCCTCCATAAAAAA
TTTTTTATGGAGGGAATAAGAGCATCACCAACCTTTCTCTTATATTCTTCCCAAATCTGATTTTGAGGGCTTTTAGGTGAAAAATCGGATCCAATGATCC[C/G]
TAGCCTTGCACATGTTTTGGAGTTCCCCATATTTATCGCTATGTTGATTTGAGGGAAAGCAAGTGCTCCTCTCCGACTCCCAATGTCCTGTCTCTCAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.00% | 0.04% | 0.72% | NA |
| All Indica | 2759 | 91.40% | 8.50% | 0.07% | 0.04% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 87.30% | 12.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 72.90% | 1.00% | 0.00% | 26.04% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223522704 | G -> DEL | N | N | silent_mutation | Average:76.64; most accessible tissue: Callus, score: 89.507 | N | N | N | N |
| vg0223522704 | G -> C | LOC_Os02g38910.1 | upstream_gene_variant ; 2153.0bp to feature; MODIFIER | silent_mutation | Average:76.64; most accessible tissue: Callus, score: 89.507 | N | N | N | N |
| vg0223522704 | G -> C | LOC_Os02g38920.1 | upstream_gene_variant ; 4814.0bp to feature; MODIFIER | silent_mutation | Average:76.64; most accessible tissue: Callus, score: 89.507 | N | N | N | N |
| vg0223522704 | G -> C | LOC_Os02g38910-LOC_Os02g38920 | intergenic_region ; MODIFIER | silent_mutation | Average:76.64; most accessible tissue: Callus, score: 89.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223522704 | 1.94E-06 | 1.94E-06 | mr1192_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | NA | 7.51E-06 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 6.02E-07 | 6.02E-07 | mr1312_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 3.95E-06 | 3.95E-06 | mr1329_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 2.54E-06 | 2.54E-06 | mr1337_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | NA | 7.90E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 3.05E-06 | 3.05E-06 | mr1374_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 2.48E-06 | 2.48E-06 | mr1524_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 7.28E-06 | 7.28E-06 | mr1634_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 4.45E-06 | 9.14E-08 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 8.52E-06 | 8.52E-06 | mr1652_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 7.11E-07 | 7.11E-07 | mr1663_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 1.87E-06 | 1.86E-06 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223522704 | 5.43E-06 | 5.43E-06 | mr1979_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |