\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223522704:

Variant ID: vg0223522704 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23522704
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTGAGAGACAGGACATTGGGAGTCGGAGAGGAGCACTTGCTTTCCCTCAAATCAACATAGCGATAAATATGGGGAACTCCAAAACATGTGCAAGGCTA[G/C]
GGATCATTGGATCCGATTTTTCACCTAAAAGCCCTCAAAATCAGATTTGGGAAGAATATAAGAGAAAGGTTGGTGATGCTCTTATTCCCTCCATAAAAAA

Reverse complement sequence

TTTTTTATGGAGGGAATAAGAGCATCACCAACCTTTCTCTTATATTCTTCCCAAATCTGATTTTGAGGGCTTTTAGGTGAAAAATCGGATCCAATGATCC[C/G]
TAGCCTTGCACATGTTTTGGAGTTCCCCATATTTATCGCTATGTTGATTTGAGGGAAAGCAAGTGCTCCTCTCCGACTCCCAATGTCCTGTCTCTCAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.00% 0.04% 0.72% NA
All Indica  2759 91.40% 8.50% 0.07% 0.04% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.10% 10.90% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 87.30% 12.50% 0.22% 0.00% NA
Indica Intermediate  786 93.40% 6.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 72.90% 1.00% 0.00% 26.04% NA
Intermediate  90 94.40% 0.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223522704 G -> DEL N N silent_mutation Average:76.64; most accessible tissue: Callus, score: 89.507 N N N N
vg0223522704 G -> C LOC_Os02g38910.1 upstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:76.64; most accessible tissue: Callus, score: 89.507 N N N N
vg0223522704 G -> C LOC_Os02g38920.1 upstream_gene_variant ; 4814.0bp to feature; MODIFIER silent_mutation Average:76.64; most accessible tissue: Callus, score: 89.507 N N N N
vg0223522704 G -> C LOC_Os02g38910-LOC_Os02g38920 intergenic_region ; MODIFIER silent_mutation Average:76.64; most accessible tissue: Callus, score: 89.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223522704 1.94E-06 1.94E-06 mr1192_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 NA 7.51E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 6.02E-07 6.02E-07 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 3.95E-06 3.95E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 2.54E-06 2.54E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 NA 7.90E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 3.05E-06 3.05E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 2.48E-06 2.48E-06 mr1524_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 7.28E-06 7.28E-06 mr1634_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 4.45E-06 9.14E-08 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 8.52E-06 8.52E-06 mr1652_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 7.11E-07 7.11E-07 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 1.87E-06 1.86E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223522704 5.43E-06 5.43E-06 mr1979_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251