\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223518691:

Variant ID: vg0223518691 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23518691
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.01, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTAAAACAAAAACTATTTGTACAATTAGGGGAAAAATCGCGAGATGAATTTTTTTAGCCTAATTAGTCTATGATTAACTATACGTGCTACAGTAACC[T/C]
ACATGTGCTAATGACGGATTAATTAGTCTCAAACGATTCGTCTCGCTGTTTCTAGCCGAGTTATGAAATTAGTTTTTTTTTATTCGTGCCCGAAAACCCC

Reverse complement sequence

GGGGTTTTCGGGCACGAATAAAAAAAAACTAATTTCATAACTCGGCTAGAAACAGCGAGACGAATCGTTTGAGACTAATTAATCCGTCATTAGCACATGT[A/G]
GGTTACTGTAGCACGTATAGTTAATCATAGACTAATTAGGCTAAAAAAATTCATCTCGCGATTTTTCCCCTAATTGTACAAATAGTTTTTGTTTTAATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 22.70% 12.06% 9.39% NA
All Indica  2759 70.60% 2.00% 14.75% 12.72% NA
All Japonica  1512 26.70% 62.40% 7.67% 3.24% NA
Aus  269 77.30% 1.10% 10.04% 11.52% NA
Indica I  595 69.70% 2.40% 15.46% 12.44% NA
Indica II  465 66.70% 2.20% 15.70% 15.48% NA
Indica III  913 76.20% 1.10% 11.72% 10.95% NA
Indica Intermediate  786 66.90% 2.50% 17.18% 13.36% NA
Temperate Japonica  767 15.00% 77.30% 6.91% 0.78% NA
Tropical Japonica  504 32.10% 51.20% 10.12% 6.55% NA
Japonica Intermediate  241 52.30% 38.60% 4.98% 4.15% NA
VI/Aromatic  96 46.90% 36.50% 8.33% 8.33% NA
Intermediate  90 42.20% 38.90% 13.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223518691 T -> DEL N N silent_mutation Average:69.544; most accessible tissue: Minghui63 flower, score: 83.256 N N N N
vg0223518691 T -> C LOC_Os02g38900.1 upstream_gene_variant ; 1087.0bp to feature; MODIFIER silent_mutation Average:69.544; most accessible tissue: Minghui63 flower, score: 83.256 N N N N
vg0223518691 T -> C LOC_Os02g38890.1 downstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:69.544; most accessible tissue: Minghui63 flower, score: 83.256 N N N N
vg0223518691 T -> C LOC_Os02g38910.1 downstream_gene_variant ; 898.0bp to feature; MODIFIER silent_mutation Average:69.544; most accessible tissue: Minghui63 flower, score: 83.256 N N N N
vg0223518691 T -> C LOC_Os02g38900-LOC_Os02g38910 intergenic_region ; MODIFIER silent_mutation Average:69.544; most accessible tissue: Minghui63 flower, score: 83.256 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223518691 NA 1.64E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 3.27E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 6.56E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.35E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 6.80E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.51E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.01E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 6.86E-06 NA mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.57E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 3.63E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 5.91E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 8.66E-06 2.14E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 5.90E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.82E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 2.99E-06 2.99E-06 mr1369_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 1.30E-06 1.30E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 3.81E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.48E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 4.59E-07 4.59E-07 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 1.07E-06 1.07E-06 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.30E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 7.13E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 2.59E-06 2.58E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.26E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 4.05E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.45E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.87E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.85E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 9.36E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.03E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 4.98E-07 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.30E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 2.92E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 7.93E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 1.66E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223518691 NA 4.12E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251