Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0223506504:

Variant ID: vg0223506504 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23506504
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGCATATTTATTATTTCTAATTTAGCTATGCAGACATGACGTGTTTGTCTCCTGTCAGTAAATTAAGTTTCCTAATTTGATTTTGATTTCAAAGGCT[G/A]
CTGCGTAGCACGCATCAAAATCTAACTCCACGCTCTTTCACGTGTCCGATTCATAAAAACAGAATCAAAGAGTCAAGCTTTTACATATATTGTGATTAAA

Reverse complement sequence

TTTAATCACAATATATGTAAAAGCTTGACTCTTTGATTCTGTTTTTATGAATCGGACACGTGAAAGAGCGTGGAGTTAGATTTTGATGCGTGCTACGCAG[C/T]
AGCCTTTGAAATCAAAATCAAATTAGGAAACTTAATTTACTGACAGGAGACAAACACGTCATGTCTGCATAGCTAAATTAGAAATAATAAATATGCACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 0.30% 0.57% 55.42% NA
All Indica  2759 32.70% 0.40% 0.65% 66.22% NA
All Japonica  1512 71.20% 0.00% 0.07% 28.70% NA
Aus  269 1.50% 0.00% 1.49% 97.03% NA
Indica I  595 50.60% 0.20% 0.17% 49.08% NA
Indica II  465 38.70% 0.20% 0.86% 60.22% NA
Indica III  913 17.20% 0.00% 0.66% 82.15% NA
Indica Intermediate  786 33.60% 1.30% 0.89% 64.25% NA
Temperate Japonica  767 80.70% 0.00% 0.13% 19.17% NA
Tropical Japonica  504 55.80% 0.00% 0.00% 44.25% NA
Japonica Intermediate  241 73.40% 0.00% 0.00% 26.56% NA
VI/Aromatic  96 37.50% 0.00% 1.04% 61.46% NA
Intermediate  90 54.40% 0.00% 3.33% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223506504 G -> A LOC_Os02g38870.1 upstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 N N N N
vg0223506504 G -> A LOC_Os02g38880.1 downstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 N N N N
vg0223506504 G -> A LOC_Os02g38860-LOC_Os02g38870 intergenic_region ; MODIFIER silent_mutation Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 N N N N
vg0223506504 G -> DEL N N silent_mutation Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223506504 NA 1.90E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 5.37E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 9.18E-06 NA mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 2.88E-06 4.13E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 3.38E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 5.74E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 1.17E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 8.94E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 8.26E-06 NA mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 6.19E-06 7.07E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 2.13E-06 NA mr1146 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 3.52E-07 6.96E-07 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 2.18E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 1.76E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 2.95E-08 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 2.56E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 9.37E-06 3.73E-07 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 1.57E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 4.03E-06 7.75E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 5.77E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 6.04E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 5.52E-10 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 3.55E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 9.13E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 1.69E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 5.78E-07 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 6.32E-08 1.85E-12 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 5.49E-06 NA mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 1.16E-06 8.95E-11 mr1075_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 4.28E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 5.28E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 1.81E-06 3.32E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 6.50E-07 NA mr1149_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 5.20E-07 4.05E-13 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 2.18E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 3.03E-08 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 6.47E-06 NA mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 3.47E-06 4.86E-13 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 4.80E-08 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 8.38E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 4.36E-09 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 7.90E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 6.37E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 8.75E-06 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223506504 NA 7.13E-11 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251