\
| Variant ID: vg0223488998 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 23488998 |
| Reference Allele: GT | Alternative Allele: G,AT,GTT |
| Primary Allele: GT | Secondary Allele: AT |
Inferred Ancestral Allele: Not determined.
AAAGTTTATAAATCAAAAGTTTGCATACATGTTTCAAATTTGAATTTAAATTCAAATATATTTTTAATATAGTATTTCTATACATATTTTTTTCAACTTT[GT/G,AT,GTT]
TTTTTTTATTTTTTTAAAAATTTATGGTGTATAGGAAGAGAAGAAGGGGATGAGGAAGGGGAGAGGAGCGTACAGGGGAATGGGGATCGATCACTCCAAT
ATTGGAGTGATCGATCCCCATTCCCCTGTACGCTCCTCTCCCCTTCCTCATCCCCTTCTTCTCTTCCTATACACCATAAATTTTTAAAAAAATAAAAAAA[AC/C,AT,AAC]
AAAGTTGAAAAAAATATGTATAGAAATACTATATTAAAAATATATTTGAATTTAAATTCAAATTTGAAACATGTATGCAAACTTTTGATTTATAAACTTT
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.40% | 19.60% | 1.76% | 1.06% | G: 17.08%; GTT: 0.11% |
| All Indica | 2759 | 47.40% | 26.60% | 2.65% | 1.59% | G: 21.75%; GTT: 0.07% |
| All Japonica | 1512 | 95.40% | 3.00% | 0.46% | 0.00% | G: 0.93%; GTT: 0.13% |
| Aus | 269 | 0.70% | 32.70% | 0.74% | 2.23% | G: 63.57% |
| Indica I | 595 | 62.00% | 8.10% | 2.02% | 0.34% | G: 27.56% |
| Indica II | 465 | 39.40% | 46.90% | 4.30% | 3.44% | G: 6.02% |
| Indica III | 913 | 44.90% | 22.70% | 1.64% | 0.99% | G: 29.57%; GTT: 0.22% |
| Indica Intermediate | 786 | 43.90% | 33.10% | 3.31% | 2.16% | G: 17.56% |
| Temperate Japonica | 767 | 98.60% | 0.90% | 0.26% | 0.00% | GTT: 0.26% |
| Tropical Japonica | 504 | 90.30% | 6.90% | 0.79% | 0.00% | G: 1.98% |
| Japonica Intermediate | 241 | 96.30% | 1.70% | 0.41% | 0.00% | G: 1.66% |
| VI/Aromatic | 96 | 39.60% | 47.90% | 0.00% | 0.00% | G: 11.46%; GTT: 1.04% |
| Intermediate | 90 | 72.20% | 14.40% | 1.11% | 0.00% | G: 12.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223488998 | GT -> G | LOC_Os02g38840.1 | downstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> G | LOC_Os02g38840.2 | downstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> G | LOC_Os02g38840-LOC_Os02g38850 | intergenic_region ; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> GTT | LOC_Os02g38840.1 | downstream_gene_variant ; 2188.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> GTT | LOC_Os02g38840.2 | downstream_gene_variant ; 2188.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> GTT | LOC_Os02g38840-LOC_Os02g38850 | intergenic_region ; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> AT | LOC_Os02g38840.1 | downstream_gene_variant ; 2186.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> AT | LOC_Os02g38840.2 | downstream_gene_variant ; 2186.0bp to feature; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> AT | LOC_Os02g38840-LOC_Os02g38850 | intergenic_region ; MODIFIER | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| vg0223488998 | GT -> DEL | N | N | silent_mutation | Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223488998 | NA | 9.14E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | 6.74E-06 | NA | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | 5.16E-06 | 4.11E-09 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 7.24E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | 1.32E-06 | NA | mr1130 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | 2.30E-06 | 1.71E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.96E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 8.97E-08 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.47E-08 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.99E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.49E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.96E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 7.28E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.65E-06 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.05E-07 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.48E-08 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 5.66E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.70E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 8.26E-09 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.77E-10 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.92E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.56E-09 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.01E-08 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.28E-11 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.84E-11 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 9.62E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.37E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.17E-08 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 7.13E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.46E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 6.11E-12 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.30E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.61E-07 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.50E-06 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.79E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.27E-07 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.87E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 3.16E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.77E-08 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 9.17E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 6.30E-09 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 4.89E-07 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 2.30E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223488998 | NA | 1.56E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |