\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223488998:

Variant ID: vg0223488998 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 23488998
Reference Allele: GTAlternative Allele: G,AT,GTT
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTTATAAATCAAAAGTTTGCATACATGTTTCAAATTTGAATTTAAATTCAAATATATTTTTAATATAGTATTTCTATACATATTTTTTTCAACTTT[GT/G,AT,GTT]
TTTTTTTATTTTTTTAAAAATTTATGGTGTATAGGAAGAGAAGAAGGGGATGAGGAAGGGGAGAGGAGCGTACAGGGGAATGGGGATCGATCACTCCAAT

Reverse complement sequence

ATTGGAGTGATCGATCCCCATTCCCCTGTACGCTCCTCTCCCCTTCCTCATCCCCTTCTTCTCTTCCTATACACCATAAATTTTTAAAAAAATAAAAAAA[AC/C,AT,AAC]
AAAGTTGAAAAAAATATGTATAGAAATACTATATTAAAAATATATTTGAATTTAAATTCAAATTTGAAACATGTATGCAAACTTTTGATTTATAAACTTT

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 19.60% 1.76% 1.06% G: 17.08%; GTT: 0.11%
All Indica  2759 47.40% 26.60% 2.65% 1.59% G: 21.75%; GTT: 0.07%
All Japonica  1512 95.40% 3.00% 0.46% 0.00% G: 0.93%; GTT: 0.13%
Aus  269 0.70% 32.70% 0.74% 2.23% G: 63.57%
Indica I  595 62.00% 8.10% 2.02% 0.34% G: 27.56%
Indica II  465 39.40% 46.90% 4.30% 3.44% G: 6.02%
Indica III  913 44.90% 22.70% 1.64% 0.99% G: 29.57%; GTT: 0.22%
Indica Intermediate  786 43.90% 33.10% 3.31% 2.16% G: 17.56%
Temperate Japonica  767 98.60% 0.90% 0.26% 0.00% GTT: 0.26%
Tropical Japonica  504 90.30% 6.90% 0.79% 0.00% G: 1.98%
Japonica Intermediate  241 96.30% 1.70% 0.41% 0.00% G: 1.66%
VI/Aromatic  96 39.60% 47.90% 0.00% 0.00% G: 11.46%; GTT: 1.04%
Intermediate  90 72.20% 14.40% 1.11% 0.00% G: 12.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223488998 GT -> G LOC_Os02g38840.1 downstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> G LOC_Os02g38840.2 downstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> G LOC_Os02g38840-LOC_Os02g38850 intergenic_region ; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> GTT LOC_Os02g38840.1 downstream_gene_variant ; 2188.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> GTT LOC_Os02g38840.2 downstream_gene_variant ; 2188.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> GTT LOC_Os02g38840-LOC_Os02g38850 intergenic_region ; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> AT LOC_Os02g38840.1 downstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> AT LOC_Os02g38840.2 downstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> AT LOC_Os02g38840-LOC_Os02g38850 intergenic_region ; MODIFIER silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N
vg0223488998 GT -> DEL N N silent_mutation Average:63.69; most accessible tissue: Minghui63 root, score: 89.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223488998 NA 9.14E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 6.74E-06 NA mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 5.16E-06 4.11E-09 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 7.24E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 1.32E-06 NA mr1130 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 2.30E-06 1.71E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.96E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 8.97E-08 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.47E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.99E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.49E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.96E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 7.28E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.65E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.05E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.48E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 5.66E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.70E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 8.26E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.77E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.92E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.56E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.01E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.28E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.84E-11 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 9.62E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.37E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.17E-08 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 7.13E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.46E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 6.11E-12 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.30E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.61E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.50E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.79E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.27E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.87E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 3.16E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.77E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 9.17E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 6.30E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 4.89E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 2.30E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223488998 NA 1.56E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251