RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0223453927:

Variant ID: vg0223453927 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23453927
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TGATTTTAGCCTGAAAGAAGAGCAATTTTACTGCGAGATGATTTCACTATCTGAAAATAAAGAGCAAATAACTCCCACATTATGTTTGGCCCCTTTGTAT[C/T]
GCAGGAATGGAAAAACGGAGGAATAGGAAAAACGTAGGATTCTGACAGGAATGCAGGTGTAAAACAGAGGATTGGAAAATACAGGAAAAACACAGGAATA

Reverse complement sequence

TATTCCTGTGTTTTTCCTGTATTTTCCAATCCTCTGTTTTACACCTGCATTCCTGTCAGAATCCTACGTTTTTCCTATTCCTCCGTTTTTCCATTCCTGC[G/A]
ATACAAAGGGGCCAAACATAATGTGGGAGTTATTTGCTCTTTATTTTCAGATAGTGAAATCATCTCGCAGTAAAATTGCTCTTCTTTCAGGCTAAAATCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	49.40%	0.11%	0.00%	NA
All Indica	2759	70.50%	29.40%	0.07%	0.00%	NA
All Japonica	1512	12.10%	87.80%	0.07%	0.00%	NA
Aus	269	66.50%	33.10%	0.37%	0.00%	NA
Indica I	595	84.40%	15.60%	0.00%	0.00%	NA
Indica II	465	72.00%	28.00%	0.00%	0.00%	NA
Indica III	913	62.90%	36.90%	0.22%	0.00%	NA
Indica Intermediate	786	68.10%	31.90%	0.00%	0.00%	NA
Temperate Japonica	767	3.40%	96.50%	0.13%	0.00%	NA
Tropical Japonica	504	12.50%	87.50%	0.00%	0.00%	NA
Japonica Intermediate	241	39.00%	61.00%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	55.20%	1.04%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223453927	C -> T	LOC_Os02g38800.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:41.222; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0223453927	C -> T	LOC_Os02g38804.1	upstream_gene_variant ; 1055.0bp to feature; MODIFIER	silent_mutation	Average:41.222; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0223453927	C -> T	LOC_Os02g38795.1	downstream_gene_variant ; 2802.0bp to feature; MODIFIER	silent_mutation	Average:41.222; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223453927	NA	5.49E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	2.12E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	1.15E-30	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	1.48E-11	mr1072	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	1.58E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	8.49E-09	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	5.40E-21	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	4.69E-09	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	1.04E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223453927	NA	1.71E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 46 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0223453927:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact