Search for Variation information by Variation ID:
Detailed information for vg0223427077:
| Variant ID: vg0223427077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23427077 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, C: 0.33, others allele: 0.00, population size: 66. )
Flanking Sequence (100 bp) in Reference Genome:
TCCTGTCATGCTGCGGTCCCATGGACCCGACCAGCTGCACCGTGCTCGTCATCGACCTCGCCTACCCGGAGCTCTGGTATTGCCGCCCCGGCGACAACCA[G/C]
TGGGTGAAGCTCCATCAACATCCGTACCAGTACCGCAACCCTGCCCACCGTGACGCCATCATCTGGGGATTACGCCAGCTTACGGCGATCGACGGCAAGT
Reverse complement sequence
ACTTGCCGTCGATCGCCGTAAGCTGGCGTAATCCCCAGATGATGGCGTCACGGTGGGCAGGGTTGCGGTACTGGTACGGATGTTGATGGAGCTTCACCCA[C/G]
TGGTTGTCGCCGGGGCGGCAATACCAGAGCTCCGGGTAGGCGAGGTCGATGACGAGCACGGTGCAGCTGGTCGGGTCCATGGGACCGCAGCATGACAGGA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 26.20% | 19.13% | 11.21% | NA |
| All Indica | 2759 | 56.10% | 4.10% | 23.09% | 16.71% | NA |
| All Japonica | 1512 | 17.50% | 70.80% | 9.85% | 1.79% | NA |
| Aus | 269 | 67.70% | 1.90% | 27.88% | 2.60% | NA |
| Indica I | 595 | 27.10% | 7.20% | 34.45% | 31.26% | NA |
| Indica II | 465 | 48.40% | 2.60% | 29.03% | 20.00% | NA |
| Indica III | 913 | 73.30% | 1.50% | 16.54% | 8.65% | NA |
| Indica Intermediate | 786 | 62.80% | 5.50% | 18.58% | 13.10% | NA |
| Temperate Japonica | 767 | 6.50% | 79.90% | 11.86% | 1.69% | NA |
| Tropical Japonica | 504 | 33.90% | 56.20% | 8.13% | 1.79% | NA |
| Japonica Intermediate | 241 | 18.30% | 72.60% | 7.05% | 2.07% | NA |
| VI/Aromatic | 96 | 33.30% | 10.40% | 27.08% | 29.17% | NA |
| Intermediate | 90 | 28.90% | 44.40% | 18.89% | 7.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223427077 | G -> DEL | LOC_Os02g38770.1 | N | frameshift_variant | Average:10.559; most accessible tissue: Callus, score: 27.573 | N | N | N | N |
| vg0223427077 | G -> C | LOC_Os02g38770.1 | missense_variant ; p.Gln144His; MODERATE | nonsynonymous_codon ; Q144D | Average:10.559; most accessible tissue: Callus, score: 27.573 | benign  |
-0.206 |
TOLERATED | 0.18 |
| vg0223427077 | G -> C | LOC_Os02g38770.1 | missense_variant ; p.Gln144His; MODERATE | nonsynonymous_codon ; Q144H | Average:10.559; most accessible tissue: Callus, score: 27.573 | benign |
-1.245 |
TOLERATED | 0.61 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223427077 | NA | 1.23E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 3.80E-26 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 6.85E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 5.96E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 1.24E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | 6.05E-07 | 6.05E-07 | mr1440_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 1.32E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 9.22E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 2.67E-08 | mr1700_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 5.10E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223427077 | NA | 3.12E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |