\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223425649:

Variant ID: vg0223425649 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23425649
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGACTGCCCAAGGTCGGTTCTCCCCTCCCAAACCGACATCGCCATCCCAATCTCTCTTGTTTTCACTCTCCACCGCTGTCGCACACCATTGTCGTCTC[G/A]
CTGTCGCCGTCCGTCGCTGAGCGTGCCGGAGGAGCTGGCGCGTTCGTGGACGCGTGACGTGAACTCCGCGCTCCCGCTTCATCCCCTTCCTCGGCCAAAA

Reverse complement sequence

TTTTGGCCGAGGAAGGGGATGAAGCGGGAGCGCGGAGTTCACGTCACGCGTCCACGAACGCGCCAGCTCCTCCGGCACGCTCAGCGACGGACGGCGACAG[C/T]
GAGACGACAATGGTGTGCGACAGCGGTGGAGAGTGAAAACAAGAGAGATTGGGATGGCGATGTCGGTTTGGGAGGGGAGAACCGACCTTGGGCAGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 19.40% 0.83% 40.29% NA
All Indica  2759 53.80% 3.20% 1.01% 42.01% NA
All Japonica  1512 21.10% 53.10% 0.66% 25.13% NA
Aus  269 2.20% 1.50% 0.37% 95.91% NA
Indica I  595 64.00% 6.40% 1.51% 28.07% NA
Indica II  465 65.60% 2.80% 1.51% 30.11% NA
Indica III  913 36.00% 0.80% 0.55% 62.65% NA
Indica Intermediate  786 59.50% 3.90% 0.89% 35.62% NA
Temperate Japonica  767 3.10% 79.50% 0.52% 16.82% NA
Tropical Japonica  504 54.40% 7.10% 0.99% 37.50% NA
Japonica Intermediate  241 8.70% 65.10% 0.41% 25.73% NA
VI/Aromatic  96 20.80% 1.00% 0.00% 78.12% NA
Intermediate  90 40.00% 24.40% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223425649 G -> A LOC_Os02g38770.1 upstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:81.935; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0223425649 G -> A LOC_Os02g38760.1 downstream_gene_variant ; 947.0bp to feature; MODIFIER silent_mutation Average:81.935; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0223425649 G -> A LOC_Os02g38760-LOC_Os02g38770 intergenic_region ; MODIFIER silent_mutation Average:81.935; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0223425649 G -> DEL N N silent_mutation Average:81.935; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223425649 G A 0.01 0.0 -0.02 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223425649 NA 5.74E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 3.51E-16 mr1740 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 4.54E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 9.31E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 1.40E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 1.82E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 6.52E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 8.79E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 5.37E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 2.81E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 1.59E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 6.18E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 8.97E-07 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425649 NA 3.62E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251