\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223425167:

Variant ID: vg0223425167 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23425167
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACTGCGGGGGATGTTAGAGTATATGGTAGTTAGAGTCATATTAGGATAGGATTGGTTTGTTTGGATTCCTTCCATATATGTAATTCTTCCTTATCTT[C/T]
TCCCCATGTACTCCTATATATATCGGCCCCCCTGAGGCTCAATACAATGTGTCCAATATTCGCAGTATCCTCTCTCCCTATACTATCTAACACTGCCGCG

Reverse complement sequence

CGCGGCAGTGTTAGATAGTATAGGGAGAGAGGATACTGCGAATATTGGACACATTGTATTGAGCCTCAGGGGGGCCGATATATATAGGAGTACATGGGGA[G/A]
AAGATAAGGAAGAATTACATATATGGAAGGAATCCAAACAAACCAATCCTATCCTAATATGACTCTAACTACCATATACTCTAACATCCCCCGCAGTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 26.20% 2.98% 22.87% NA
All Indica  2759 71.50% 3.80% 3.01% 21.60% NA
All Japonica  1512 5.30% 71.20% 0.86% 22.62% NA
Aus  269 50.90% 1.50% 11.90% 35.69% NA
Indica I  595 77.00% 6.10% 6.05% 10.92% NA
Indica II  465 77.00% 2.60% 0.86% 19.57% NA
Indica III  913 61.60% 1.80% 2.08% 34.61% NA
Indica Intermediate  786 75.80% 5.30% 3.05% 15.78% NA
Temperate Japonica  767 2.90% 80.20% 0.26% 16.69% NA
Tropical Japonica  504 9.30% 56.50% 1.79% 32.34% NA
Japonica Intermediate  241 4.60% 73.40% 0.83% 21.16% NA
VI/Aromatic  96 50.00% 10.40% 9.38% 30.21% NA
Intermediate  90 30.00% 45.60% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223425167 C -> T LOC_Os02g38770.1 upstream_gene_variant ; 1479.0bp to feature; MODIFIER silent_mutation Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0223425167 C -> T LOC_Os02g38760.1 downstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0223425167 C -> T LOC_Os02g38760-LOC_Os02g38770 intergenic_region ; MODIFIER silent_mutation Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0223425167 C -> DEL N N silent_mutation Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223425167 NA 2.92E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 3.03E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 1.58E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 2.16E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 1.62E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 6.04E-06 NA mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 4.22E-06 4.22E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 1.82E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 8.65E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 3.24E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 2.18E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 1.23E-06 mr1785_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223425167 NA 4.75E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251