\
| Variant ID: vg0223425167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23425167 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 47. )
TGGACTGCGGGGGATGTTAGAGTATATGGTAGTTAGAGTCATATTAGGATAGGATTGGTTTGTTTGGATTCCTTCCATATATGTAATTCTTCCTTATCTT[C/T]
TCCCCATGTACTCCTATATATATCGGCCCCCCTGAGGCTCAATACAATGTGTCCAATATTCGCAGTATCCTCTCTCCCTATACTATCTAACACTGCCGCG
CGCGGCAGTGTTAGATAGTATAGGGAGAGAGGATACTGCGAATATTGGACACATTGTATTGAGCCTCAGGGGGGCCGATATATATAGGAGTACATGGGGA[G/A]
AAGATAAGGAAGAATTACATATATGGAAGGAATCCAAACAAACCAATCCTATCCTAATATGACTCTAACTACCATATACTCTAACATCCCCCGCAGTCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 26.20% | 2.98% | 22.87% | NA |
| All Indica | 2759 | 71.50% | 3.80% | 3.01% | 21.60% | NA |
| All Japonica | 1512 | 5.30% | 71.20% | 0.86% | 22.62% | NA |
| Aus | 269 | 50.90% | 1.50% | 11.90% | 35.69% | NA |
| Indica I | 595 | 77.00% | 6.10% | 6.05% | 10.92% | NA |
| Indica II | 465 | 77.00% | 2.60% | 0.86% | 19.57% | NA |
| Indica III | 913 | 61.60% | 1.80% | 2.08% | 34.61% | NA |
| Indica Intermediate | 786 | 75.80% | 5.30% | 3.05% | 15.78% | NA |
| Temperate Japonica | 767 | 2.90% | 80.20% | 0.26% | 16.69% | NA |
| Tropical Japonica | 504 | 9.30% | 56.50% | 1.79% | 32.34% | NA |
| Japonica Intermediate | 241 | 4.60% | 73.40% | 0.83% | 21.16% | NA |
| VI/Aromatic | 96 | 50.00% | 10.40% | 9.38% | 30.21% | NA |
| Intermediate | 90 | 30.00% | 45.60% | 4.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223425167 | C -> T | LOC_Os02g38770.1 | upstream_gene_variant ; 1479.0bp to feature; MODIFIER | silent_mutation | Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0223425167 | C -> T | LOC_Os02g38760.1 | downstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0223425167 | C -> T | LOC_Os02g38760-LOC_Os02g38770 | intergenic_region ; MODIFIER | silent_mutation | Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0223425167 | C -> DEL | N | N | silent_mutation | Average:53.321; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223425167 | NA | 2.92E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 3.03E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 1.58E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 2.16E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 1.62E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | 6.04E-06 | NA | mr1440_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | 4.22E-06 | 4.22E-06 | mr1440_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 1.82E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 8.65E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 3.24E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 2.18E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 1.23E-06 | mr1785_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223425167 | NA | 4.75E-09 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |