\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223422615:

Variant ID: vg0223422615 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23422615
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACATCGTCAGATCCCAATCCCCCAATCCATCGTCAAGTTCGAATTCCAACTTCAAGTCCCCTCCAAATCAAATCTCTCGACAGAAGTCTATTTCGCCT[C/T]
CCTAAAGTTTTGTGGGCCGAGCTCCCTCCCTCGGCACATCTTCTCCCTCAGCCCATCCCCTCCTCTCGCACATGCCGTGCGAGTGCGCTGAGCCGAGCCG

Reverse complement sequence

CGGCTCGGCTCAGCGCACTCGCACGGCATGTGCGAGAGGAGGGGATGGGCTGAGGGAGAAGATGTGCCGAGGGAGGGAGCTCGGCCCACAAAACTTTAGG[G/A]
AGGCGAAATAGACTTCTGTCGAGAGATTTGATTTGGAGGGGACTTGAAGTTGGAATTCGAACTTGACGATGGATTGGGGGATTGGGATCTGACGATGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 26.10% 0.72% 40.35% NA
All Indica  2759 53.20% 4.00% 0.80% 42.01% NA
All Japonica  1512 3.20% 70.70% 0.53% 25.60% NA
Aus  269 2.20% 1.50% 1.12% 95.17% NA
Indica I  595 64.20% 6.40% 0.50% 28.91% NA
Indica II  465 65.20% 3.00% 1.94% 29.89% NA
Indica III  913 35.40% 1.90% 0.44% 62.32% NA
Indica Intermediate  786 58.70% 5.10% 0.76% 35.50% NA
Temperate Japonica  767 2.50% 79.40% 0.52% 17.60% NA
Tropical Japonica  504 5.60% 56.30% 0.79% 37.30% NA
Japonica Intermediate  241 0.40% 73.00% 0.00% 26.56% NA
VI/Aromatic  96 11.50% 11.50% 1.04% 76.04% NA
Intermediate  90 18.90% 45.60% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223422615 C -> T LOC_Os02g38750.1 upstream_gene_variant ; 3859.0bp to feature; MODIFIER silent_mutation Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg0223422615 C -> T LOC_Os02g38770.1 upstream_gene_variant ; 4031.0bp to feature; MODIFIER silent_mutation Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg0223422615 C -> T LOC_Os02g38760.1 intron_variant ; MODIFIER silent_mutation Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg0223422615 C -> DEL N N silent_mutation Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223422615 NA 5.14E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 7.92E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 3.81E-06 NA mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 4.31E-06 NA mr1148_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 1.09E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 4.63E-06 NA mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 4.93E-14 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 9.20E-06 1.05E-08 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 3.41E-06 9.83E-08 mr1252_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 6.71E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 1.37E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 6.93E-06 6.93E-06 mr1387_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 4.80E-06 1.38E-08 mr1555_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 1.98E-06 NA mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 1.25E-06 4.38E-28 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 3.24E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 4.89E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 9.87E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 1.14E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 2.98E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 3.85E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 9.73E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 9.89E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 6.62E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615 NA 2.84E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251