Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223422615:

Variant ID: vg0223422615 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23422615
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACATCGTCAGATCCCAATCCCCCAATCCATCGTCAAGTTCGAATTCCAACTTCAAGTCCCCTCCAAATCAAATCTCTCGACAGAAGTCTATTTCGCCT[C/T]
CCTAAAGTTTTGTGGGCCGAGCTCCCTCCCTCGGCACATCTTCTCCCTCAGCCCATCCCCTCCTCTCGCACATGCCGTGCGAGTGCGCTGAGCCGAGCCG

Reverse complement sequence

CGGCTCGGCTCAGCGCACTCGCACGGCATGTGCGAGAGGAGGGGATGGGCTGAGGGAGAAGATGTGCCGAGGGAGGGAGCTCGGCCCACAAAACTTTAGG[G/A]
AGGCGAAATAGACTTCTGTCGAGAGATTTGATTTGGAGGGGACTTGAAGTTGGAATTCGAACTTGACGATGGATTGGGGGATTGGGATCTGACGATGTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.80%	26.10%	0.72%	40.35%	NA
All Indica	2759	53.20%	4.00%	0.80%	42.01%	NA
All Japonica	1512	3.20%	70.70%	0.53%	25.60%	NA
Aus	269	2.20%	1.50%	1.12%	95.17%	NA
Indica I	595	64.20%	6.40%	0.50%	28.91%	NA
Indica II	465	65.20%	3.00%	1.94%	29.89%	NA
Indica III	913	35.40%	1.90%	0.44%	62.32%	NA
Indica Intermediate	786	58.70%	5.10%	0.76%	35.50%	NA
Temperate Japonica	767	2.50%	79.40%	0.52%	17.60%	NA
Tropical Japonica	504	5.60%	56.30%	0.79%	37.30%	NA
Japonica Intermediate	241	0.40%	73.00%	0.00%	26.56%	NA
VI/Aromatic	96	11.50%	11.50%	1.04%	76.04%	NA
Intermediate	90	18.90%	45.60%	0.00%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223422615	C -> T	LOC_Os02g38750.1	upstream_gene_variant ; 3859.0bp to feature; MODIFIER	silent_mutation	Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182	N	N	N	N
vg0223422615	C -> T	LOC_Os02g38770.1	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182	N	N	N	N
vg0223422615	C -> T	LOC_Os02g38760.1	intron_variant ; MODIFIER	silent_mutation	Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182	N	N	N	N
vg0223422615	C -> DEL	N	N	silent_mutation	Average:55.662; most accessible tissue: Minghui63 flag leaf, score: 69.182	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223422615	NA	5.14E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	7.92E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	3.81E-06	NA	mr1092_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	4.31E-06	NA	mr1148_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	1.09E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	4.63E-06	NA	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	4.93E-14	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	9.20E-06	1.05E-08	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	3.41E-06	9.83E-08	mr1252_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	6.71E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	1.37E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	6.93E-06	6.93E-06	mr1387_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	4.80E-06	1.38E-08	mr1555_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	1.98E-06	NA	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	1.25E-06	4.38E-28	mr1617_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	3.24E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	4.89E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	9.87E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	1.14E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	2.98E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	3.85E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	9.73E-06	NA	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	9.89E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	6.62E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223422615	NA	2.84E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251