\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223395306:

Variant ID: vg0223395306 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23395306
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGGCCGACGGCGGCGCGTCACGATGCCGAGATGGGCAAGTGTTGTCTGGGAGACTGGGATTGGCTGATTGCAGAGCAGTGGCGTGGAAGCCAAACAGA[T/C]
GCGAGGCGGAGTCGTCAAGATTGGCAGCGACGGGACGCGGCATACGAGAAGTCGAGAAGAGAAAAGATTGATCTGGATTCGACTCTCCTCATGGGCTTAC

Reverse complement sequence

GTAAGCCCATGAGGAGAGTCGAATCCAGATCAATCTTTTCTCTTCTCGACTTCTCGTATGCCGCGTCCCGTCGCTGCCAATCTTGACGACTCCGCCTCGC[A/G]
TCTGTTTGGCTTCCACGCCACTGCTCTGCAATCAGCCAATCCCAGTCTCCCAGACAACACTTGCCCATCTCGGCATCGTGACGCGCCGCCGTCGGCCGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 7.40% 1.99% 39.65% NA
All Indica  2759 54.50% 0.70% 2.14% 42.70% NA
All Japonica  1512 56.00% 18.00% 1.06% 24.93% NA
Aus  269 3.00% 0.00% 4.46% 92.57% NA
Indica I  595 61.30% 0.00% 0.84% 37.82% NA
Indica II  465 67.70% 0.40% 1.94% 29.89% NA
Indica III  913 36.10% 0.90% 3.18% 59.80% NA
Indica Intermediate  786 62.70% 1.10% 2.04% 34.10% NA
Temperate Japonica  767 81.10% 0.70% 0.91% 17.34% NA
Tropical Japonica  504 13.30% 48.60% 1.79% 36.31% NA
Japonica Intermediate  241 65.60% 9.10% 0.00% 25.31% NA
VI/Aromatic  96 9.40% 41.70% 2.08% 46.88% NA
Intermediate  90 43.30% 23.30% 5.56% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223395306 T -> DEL N N silent_mutation Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0223395306 T -> C LOC_Os02g38710.1 upstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0223395306 T -> C LOC_Os02g38690.1 downstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0223395306 T -> C LOC_Os02g38700.1 intron_variant ; MODIFIER silent_mutation Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223395306 4.05E-06 1.87E-11 mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223395306 NA 5.54E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223395306 NA 1.87E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251