\
| Variant ID: vg0223395306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23395306 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACGGCCGACGGCGGCGCGTCACGATGCCGAGATGGGCAAGTGTTGTCTGGGAGACTGGGATTGGCTGATTGCAGAGCAGTGGCGTGGAAGCCAAACAGA[T/C]
GCGAGGCGGAGTCGTCAAGATTGGCAGCGACGGGACGCGGCATACGAGAAGTCGAGAAGAGAAAAGATTGATCTGGATTCGACTCTCCTCATGGGCTTAC
GTAAGCCCATGAGGAGAGTCGAATCCAGATCAATCTTTTCTCTTCTCGACTTCTCGTATGCCGCGTCCCGTCGCTGCCAATCTTGACGACTCCGCCTCGC[A/G]
TCTGTTTGGCTTCCACGCCACTGCTCTGCAATCAGCCAATCCCAGTCTCCCAGACAACACTTGCCCATCTCGGCATCGTGACGCGCCGCCGTCGGCCGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 7.40% | 1.99% | 39.65% | NA |
| All Indica | 2759 | 54.50% | 0.70% | 2.14% | 42.70% | NA |
| All Japonica | 1512 | 56.00% | 18.00% | 1.06% | 24.93% | NA |
| Aus | 269 | 3.00% | 0.00% | 4.46% | 92.57% | NA |
| Indica I | 595 | 61.30% | 0.00% | 0.84% | 37.82% | NA |
| Indica II | 465 | 67.70% | 0.40% | 1.94% | 29.89% | NA |
| Indica III | 913 | 36.10% | 0.90% | 3.18% | 59.80% | NA |
| Indica Intermediate | 786 | 62.70% | 1.10% | 2.04% | 34.10% | NA |
| Temperate Japonica | 767 | 81.10% | 0.70% | 0.91% | 17.34% | NA |
| Tropical Japonica | 504 | 13.30% | 48.60% | 1.79% | 36.31% | NA |
| Japonica Intermediate | 241 | 65.60% | 9.10% | 0.00% | 25.31% | NA |
| VI/Aromatic | 96 | 9.40% | 41.70% | 2.08% | 46.88% | NA |
| Intermediate | 90 | 43.30% | 23.30% | 5.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223395306 | T -> DEL | N | N | silent_mutation | Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg0223395306 | T -> C | LOC_Os02g38710.1 | upstream_gene_variant ; 3091.0bp to feature; MODIFIER | silent_mutation | Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg0223395306 | T -> C | LOC_Os02g38690.1 | downstream_gene_variant ; 3466.0bp to feature; MODIFIER | silent_mutation | Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg0223395306 | T -> C | LOC_Os02g38700.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223395306 | 4.05E-06 | 1.87E-11 | mr1449_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223395306 | NA | 5.54E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223395306 | NA | 1.87E-09 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |