Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223395306:

Variant ID: vg0223395306 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23395306
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGGCCGACGGCGGCGCGTCACGATGCCGAGATGGGCAAGTGTTGTCTGGGAGACTGGGATTGGCTGATTGCAGAGCAGTGGCGTGGAAGCCAAACAGA[T/C]
GCGAGGCGGAGTCGTCAAGATTGGCAGCGACGGGACGCGGCATACGAGAAGTCGAGAAGAGAAAAGATTGATCTGGATTCGACTCTCCTCATGGGCTTAC

Reverse complement sequence

GTAAGCCCATGAGGAGAGTCGAATCCAGATCAATCTTTTCTCTTCTCGACTTCTCGTATGCCGCGTCCCGTCGCTGCCAATCTTGACGACTCCGCCTCGC[A/G]
TCTGTTTGGCTTCCACGCCACTGCTCTGCAATCAGCCAATCCCAGTCTCCCAGACAACACTTGCCCATCTCGGCATCGTGACGCGCCGCCGTCGGCCGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	7.40%	1.99%	39.65%	NA
All Indica	2759	54.50%	0.70%	2.14%	42.70%	NA
All Japonica	1512	56.00%	18.00%	1.06%	24.93%	NA
Aus	269	3.00%	0.00%	4.46%	92.57%	NA
Indica I	595	61.30%	0.00%	0.84%	37.82%	NA
Indica II	465	67.70%	0.40%	1.94%	29.89%	NA
Indica III	913	36.10%	0.90%	3.18%	59.80%	NA
Indica Intermediate	786	62.70%	1.10%	2.04%	34.10%	NA
Temperate Japonica	767	81.10%	0.70%	0.91%	17.34%	NA
Tropical Japonica	504	13.30%	48.60%	1.79%	36.31%	NA
Japonica Intermediate	241	65.60%	9.10%	0.00%	25.31%	NA
VI/Aromatic	96	9.40%	41.70%	2.08%	46.88%	NA
Intermediate	90	43.30%	23.30%	5.56%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223395306	T -> DEL	N	N	silent_mutation	Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0223395306	T -> C	LOC_Os02g38710.1	upstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0223395306	T -> C	LOC_Os02g38690.1	downstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0223395306	T -> C	LOC_Os02g38700.1	intron_variant ; MODIFIER	silent_mutation	Average:60.842; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223395306	4.05E-06	1.87E-11	mr1449_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223395306	NA	5.54E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223395306	NA	1.87E-09	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251