| Variant ID: vg0223354397 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23354397 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGCCGGCCCAAGAGGGAAGGGGGGGGGGAAAAAGAACTTCTTTTAGGATTTTCTTTTTTTTTATAAACCTTTTCCACTTTGTTTATTTCTTTTCAATTAT[T/C]
ATTTGTGCTCTGAAAATTCCACTAAAATTTGTTTAAGCATTTTAGGCTTTTAGGAAATATACAAAAATCCTCCAAGCCTCATTTGACTTTTACATTTGCA
TGCAAATGTAAAAGTCAAATGAGGCTTGGAGGATTTTTGTATATTTCCTAAAAGCCTAAAATGCTTAAACAAATTTTAGTGGAATTTTCAGAGCACAAAT[A/G]
ATAATTGAAAAGAAATAAACAAAGTGGAAAAGGTTTATAAAAAAAAAGAAAATCCTAAAAGAAGTTCTTTTTCCCCCCCCCCTTCCCTCTTGGGCCGGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.60% | 0.30% | 42.76% | 37.37% | NA |
| All Indica | 2759 | 5.40% | 0.50% | 60.89% | 33.16% | NA |
| All Japonica | 1512 | 48.70% | 0.00% | 13.69% | 37.63% | NA |
| Aus | 269 | 2.60% | 0.00% | 10.04% | 87.36% | NA |
| Indica I | 595 | 8.10% | 0.00% | 46.89% | 45.04% | NA |
| Indica II | 465 | 3.00% | 0.20% | 59.35% | 37.42% | NA |
| Indica III | 913 | 1.00% | 1.10% | 75.03% | 22.89% | NA |
| Indica Intermediate | 786 | 9.90% | 0.50% | 55.98% | 33.59% | NA |
| Temperate Japonica | 767 | 78.90% | 0.00% | 10.04% | 11.08% | NA |
| Tropical Japonica | 504 | 7.50% | 0.00% | 15.67% | 76.79% | NA |
| Japonica Intermediate | 241 | 38.60% | 0.00% | 21.16% | 40.25% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 71.88% | 20.83% | NA |
| Intermediate | 90 | 27.80% | 0.00% | 42.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223354397 | T -> DEL | N | N | silent_mutation | Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg0223354397 | T -> C | LOC_Os02g38630.1 | upstream_gene_variant ; 3200.0bp to feature; MODIFIER | silent_mutation | Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg0223354397 | T -> C | LOC_Os02g38650.1 | upstream_gene_variant ; 3406.0bp to feature; MODIFIER | silent_mutation | Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg0223354397 | T -> C | LOC_Os02g38640.1 | downstream_gene_variant ; 229.0bp to feature; MODIFIER | silent_mutation | Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg0223354397 | T -> C | LOC_Os02g38630-LOC_Os02g38640 | intergenic_region ; MODIFIER | silent_mutation | Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223354397 | NA | 7.83E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 2.88E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | 4.52E-06 | 2.82E-09 | mr1116 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 5.70E-07 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 8.84E-11 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 7.58E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 3.23E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 2.62E-08 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 1.50E-15 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223354397 | NA | 1.17E-12 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/