Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223354397:

Variant ID: vg0223354397 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23354397
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCCGGCCCAAGAGGGAAGGGGGGGGGGAAAAAGAACTTCTTTTAGGATTTTCTTTTTTTTTATAAACCTTTTCCACTTTGTTTATTTCTTTTCAATTAT[T/C]
ATTTGTGCTCTGAAAATTCCACTAAAATTTGTTTAAGCATTTTAGGCTTTTAGGAAATATACAAAAATCCTCCAAGCCTCATTTGACTTTTACATTTGCA

Reverse complement sequence

TGCAAATGTAAAAGTCAAATGAGGCTTGGAGGATTTTTGTATATTTCCTAAAAGCCTAAAATGCTTAAACAAATTTTAGTGGAATTTTCAGAGCACAAAT[A/G]
ATAATTGAAAAGAAATAAACAAAGTGGAAAAGGTTTATAAAAAAAAAGAAAATCCTAAAAGAAGTTCTTTTTCCCCCCCCCCTTCCCTCTTGGGCCGGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.60%	0.30%	42.76%	37.37%	NA
All Indica	2759	5.40%	0.50%	60.89%	33.16%	NA
All Japonica	1512	48.70%	0.00%	13.69%	37.63%	NA
Aus	269	2.60%	0.00%	10.04%	87.36%	NA
Indica I	595	8.10%	0.00%	46.89%	45.04%	NA
Indica II	465	3.00%	0.20%	59.35%	37.42%	NA
Indica III	913	1.00%	1.10%	75.03%	22.89%	NA
Indica Intermediate	786	9.90%	0.50%	55.98%	33.59%	NA
Temperate Japonica	767	78.90%	0.00%	10.04%	11.08%	NA
Tropical Japonica	504	7.50%	0.00%	15.67%	76.79%	NA
Japonica Intermediate	241	38.60%	0.00%	21.16%	40.25%	NA
VI/Aromatic	96	7.30%	0.00%	71.88%	20.83%	NA
Intermediate	90	27.80%	0.00%	42.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223354397	T -> DEL	N	N	silent_mutation	Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0223354397	T -> C	LOC_Os02g38630.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0223354397	T -> C	LOC_Os02g38650.1	upstream_gene_variant ; 3406.0bp to feature; MODIFIER	silent_mutation	Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0223354397	T -> C	LOC_Os02g38640.1	downstream_gene_variant ; 229.0bp to feature; MODIFIER	silent_mutation	Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0223354397	T -> C	LOC_Os02g38630-LOC_Os02g38640	intergenic_region ; MODIFIER	silent_mutation	Average:11.069; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223354397	NA	7.83E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	2.88E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	4.52E-06	2.82E-09	mr1116	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	5.70E-07	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	8.84E-11	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	7.58E-07	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	3.23E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	2.62E-08	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	1.50E-15	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	1.17E-12	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	7.39E-10	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	9.13E-11	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	4.11E-11	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	2.10E-09	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	3.14E-12	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	7.34E-09	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	7.95E-11	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	3.61E-10	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	1.28E-06	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	2.27E-14	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	6.45E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	3.86E-13	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223354397	NA	7.89E-07	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251