\
| Variant ID: vg0223273272 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23273272 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )
AGTTAACATGGCTGTCATGTTTTGGGTCAGGCCCCATGGGCTTGTGTGATGTTTAGTTTCTTTACTTGCTCTGAACCTTTTGTAAGAATCTTATCATTTC[G/A]
TTAATGAAATGGGAGGGTCTCCGCTCTCTGTCTCAAAAAAAAAAAATCATGGAAGGGGTCTGTGATAAAAAAAAAGGAGGTCTTGAGTTTTTGTTTTGAC
GTCAAAACAAAAACTCAAGACCTCCTTTTTTTTTATCACAGACCCCTTCCATGATTTTTTTTTTTTGAGACAGAGAGCGGAGACCCTCCCATTTCATTAA[C/T]
GAAATGATAAGATTCTTACAAAAGGTTCAGAGCAAGTAAAGAAACTAAACATCACACAAGCCCATGGGGCCTGACCCAAAACATGACAGCCATGTTAACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.50% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 82.20% | 17.20% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.60% | 5.90% | 1.49% | 0.00% | NA |
| Indica I | 595 | 70.40% | 27.90% | 1.68% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 76.50% | 23.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 9.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223273272 | G -> A | LOC_Os02g38490.1 | 3_prime_UTR_variant ; 136.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 66.394 | N | N | N | N |
| vg0223273272 | G -> A | LOC_Os02g38490.2 | 3_prime_UTR_variant ; 210.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 66.394 | N | N | N | N |
| vg0223273272 | G -> A | LOC_Os02g38490.3 | 3_prime_UTR_variant ; 303.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 66.394 | N | N | N | N |
| vg0223273272 | G -> A | LOC_Os02g38480.1 | downstream_gene_variant ; 1322.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 66.394 | N | N | N | N |
| vg0223273272 | G -> A | LOC_Os02g38490.4 | intron_variant ; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 66.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223273272 | NA | 2.71E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | NA | 2.30E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | NA | 2.34E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | NA | 4.03E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | 4.78E-06 | NA | mr1149_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | NA | 4.87E-09 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223273272 | NA | 6.54E-09 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |