\
| Variant ID: vg0223219897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23219897 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTTGTCTTGTGAGGGTTTATATTACCGGTTGACCACTAAATTTCGAGCCTCATCGGTATCATGTTTTTTGATAAATTTTGATCGGTTTCGGATAAATTT[C/T]
GACTGAATTTCGACCAAATCTACTGTTTAACCTTCGAAATTCCAATCGAAACTTAATTTTGAGCCGCGTCGAAACGTCGAAATTTCGCGGAACTCGACCG
CGGTCGAGTTCCGCGAAATTTCGACGTTTCGACGCGGCTCAAAATTAAGTTTCGATTGGAATTTCGAAGGTTAAACAGTAGATTTGGTCGAAATTCAGTC[G/A]
AAATTTATCCGAAACCGATCAAAATTTATCAAAAAACATGATACCGATGAGGCTCGAAATTTAGTGGTCAACCGGTAATATAAACCCTCACAAGACAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 4.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 8.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 2.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223219897 | C -> T | LOC_Os02g38392.1 | 3_prime_UTR_variant ; 146.0bp to feature; MODIFIER | silent_mutation | Average:53.491; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223219897 | NA | 2.51E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | NA | 5.50E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | NA | 5.46E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | NA | 2.41E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | NA | 1.76E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | NA | 4.58E-07 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223219897 | 2.52E-07 | 7.98E-07 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |