Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223190854:

Variant ID: vg0223190854 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23190854
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCCATGGTGGGTCAGCCATTCCGCAGTCGTATCGCACGCGAATAAAGGAGGTTGCATCGGTGCGACAGAAAGTAGTCGTGCATGTGCCGAAAGGTATC[A/G]
TGCTTTCGTAAAAAGTAACAGCGAAGTTTAGTGATGCGAAACCCGAATAACAACAACGTATTCATTATACAAGCATACAGTACTAGCATGTAAAGTAAAT

Reverse complement sequence

ATTTACTTTACATGCTAGTACTGTATGCTTGTATAATGAATACGTTGTTGTTATTCGGGTTTCGCATCACTAAACTTCGCTGTTACTTTTTACGAAAGCA[T/C]
GATACCTTTCGGCACATGCACGACTACTTTCTGTCGCACCGATGCAACCTCCTTTATTCGCGTGCGATACGACTGCGGAATGGCTGACCCACCATGGCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	44.30%	0.25%	0.13%	NA
All Indica	2759	49.50%	50.10%	0.25%	0.14%	NA
All Japonica	1512	78.60%	21.00%	0.20%	0.13%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	59.50%	40.20%	0.34%	0.00%	NA
Indica II	465	38.70%	60.90%	0.43%	0.00%	NA
Indica III	913	57.50%	42.30%	0.00%	0.22%	NA
Indica Intermediate	786	38.90%	60.40%	0.38%	0.25%	NA
Temperate Japonica	767	95.40%	4.30%	0.00%	0.26%	NA
Tropical Japonica	504	64.90%	34.70%	0.40%	0.00%	NA
Japonica Intermediate	241	53.90%	45.60%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	1.04%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223190854	A -> G	LOC_Os02g38350.1	upstream_gene_variant ; 4381.0bp to feature; MODIFIER	silent_mutation	Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0223190854	A -> G	LOC_Os02g38350.3	upstream_gene_variant ; 4393.0bp to feature; MODIFIER	silent_mutation	Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0223190854	A -> G	LOC_Os02g38350.2	upstream_gene_variant ; 4379.0bp to feature; MODIFIER	silent_mutation	Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0223190854	A -> G	LOC_Os02g38350-LOC_Os02g38370	intergenic_region ; MODIFIER	silent_mutation	Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0223190854	A -> DEL	N	N	silent_mutation	Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223190854	NA	4.57E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	8.31E-07	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	1.92E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	8.55E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	1.28E-10	mr1190	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	8.02E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	5.96E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	5.01E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854	NA	9.14E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251