\
| Variant ID: vg0223190854 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23190854 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )
GGGCCATGGTGGGTCAGCCATTCCGCAGTCGTATCGCACGCGAATAAAGGAGGTTGCATCGGTGCGACAGAAAGTAGTCGTGCATGTGCCGAAAGGTATC[A/G]
TGCTTTCGTAAAAAGTAACAGCGAAGTTTAGTGATGCGAAACCCGAATAACAACAACGTATTCATTATACAAGCATACAGTACTAGCATGTAAAGTAAAT
ATTTACTTTACATGCTAGTACTGTATGCTTGTATAATGAATACGTTGTTGTTATTCGGGTTTCGCATCACTAAACTTCGCTGTTACTTTTTACGAAAGCA[T/C]
GATACCTTTCGGCACATGCACGACTACTTTCTGTCGCACCGATGCAACCTCCTTTATTCGCGTGCGATACGACTGCGGAATGGCTGACCCACCATGGCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 44.30% | 0.25% | 0.13% | NA |
| All Indica | 2759 | 49.50% | 50.10% | 0.25% | 0.14% | NA |
| All Japonica | 1512 | 78.60% | 21.00% | 0.20% | 0.13% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.50% | 40.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 38.70% | 60.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 57.50% | 42.30% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 38.90% | 60.40% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 95.40% | 4.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 64.90% | 34.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.90% | 45.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223190854 | A -> G | LOC_Os02g38350.1 | upstream_gene_variant ; 4381.0bp to feature; MODIFIER | silent_mutation | Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0223190854 | A -> G | LOC_Os02g38350.3 | upstream_gene_variant ; 4393.0bp to feature; MODIFIER | silent_mutation | Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0223190854 | A -> G | LOC_Os02g38350.2 | upstream_gene_variant ; 4379.0bp to feature; MODIFIER | silent_mutation | Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0223190854 | A -> G | LOC_Os02g38350-LOC_Os02g38370 | intergenic_region ; MODIFIER | silent_mutation | Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0223190854 | A -> DEL | N | N | silent_mutation | Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223190854 | NA | 4.57E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 8.31E-07 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 1.92E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 8.55E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 1.28E-10 | mr1190 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 8.02E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 5.96E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 5.01E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223190854 | NA | 9.14E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |