\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223190854:

Variant ID: vg0223190854 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23190854
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCCATGGTGGGTCAGCCATTCCGCAGTCGTATCGCACGCGAATAAAGGAGGTTGCATCGGTGCGACAGAAAGTAGTCGTGCATGTGCCGAAAGGTATC[A/G]
TGCTTTCGTAAAAAGTAACAGCGAAGTTTAGTGATGCGAAACCCGAATAACAACAACGTATTCATTATACAAGCATACAGTACTAGCATGTAAAGTAAAT

Reverse complement sequence

ATTTACTTTACATGCTAGTACTGTATGCTTGTATAATGAATACGTTGTTGTTATTCGGGTTTCGCATCACTAAACTTCGCTGTTACTTTTTACGAAAGCA[T/C]
GATACCTTTCGGCACATGCACGACTACTTTCTGTCGCACCGATGCAACCTCCTTTATTCGCGTGCGATACGACTGCGGAATGGCTGACCCACCATGGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.30% 0.25% 0.13% NA
All Indica  2759 49.50% 50.10% 0.25% 0.14% NA
All Japonica  1512 78.60% 21.00% 0.20% 0.13% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 59.50% 40.20% 0.34% 0.00% NA
Indica II  465 38.70% 60.90% 0.43% 0.00% NA
Indica III  913 57.50% 42.30% 0.00% 0.22% NA
Indica Intermediate  786 38.90% 60.40% 0.38% 0.25% NA
Temperate Japonica  767 95.40% 4.30% 0.00% 0.26% NA
Tropical Japonica  504 64.90% 34.70% 0.40% 0.00% NA
Japonica Intermediate  241 53.90% 45.60% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223190854 A -> G LOC_Os02g38350.1 upstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0223190854 A -> G LOC_Os02g38350.3 upstream_gene_variant ; 4393.0bp to feature; MODIFIER silent_mutation Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0223190854 A -> G LOC_Os02g38350.2 upstream_gene_variant ; 4379.0bp to feature; MODIFIER silent_mutation Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0223190854 A -> G LOC_Os02g38350-LOC_Os02g38370 intergenic_region ; MODIFIER silent_mutation Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0223190854 A -> DEL N N silent_mutation Average:57.396; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223190854 NA 4.57E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 8.31E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 1.92E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 8.55E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 1.28E-10 mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 8.02E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 5.96E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 5.01E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223190854 NA 9.14E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251