\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223177745:

Variant ID: vg0223177745 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23177745
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGGTCGGTGCCGGCCGCTTCGGGCGCGCGTGGAGGTGGTTGCTGCTGCTGCTGCTGCTGGGGGCGGCAGAAGCTAGTGGCGGTGGGTGTGGGATGCCC[G/A]
CCGCGACGCCGACCCGCTCTCGCCTCCTCTTCCCCGCGTTGCGGCCGCGGCCGGTGGTGGTTAAAGCGGACGGGGGAAGCCTCGCCGCTGCCGGTGACTG

Reverse complement sequence

CAGTCACCGGCAGCGGCGAGGCTTCCCCCGTCCGCTTTAACCACCACCGGCCGCGGCCGCAACGCGGGGAAGAGGAGGCGAGAGCGGGTCGGCGTCGCGG[C/T]
GGGCATCCCACACCCACCGCCACTAGCTTCTGCCGCCCCCAGCAGCAGCAGCAGCAGCAACCACCTCCACGCGCGCCCGAAGCGGCCGGCACCGACCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 35.10% 0.08% 0.00% NA
All Indica  2759 54.40% 45.50% 0.14% 0.00% NA
All Japonica  1512 89.90% 10.10% 0.00% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 52.90% 46.70% 0.34% 0.00% NA
Indica II  465 63.70% 36.30% 0.00% 0.00% NA
Indica III  913 52.40% 47.50% 0.11% 0.00% NA
Indica Intermediate  786 52.30% 47.60% 0.13% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 72.80% 27.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223177745 G -> A LOC_Os02g38340.1 5_prime_UTR_variant ; 156.0bp to feature; MODIFIER silent_mutation Average:96.502; most accessible tissue: Minghui63 panicle, score: 99.037 N N N N
vg0223177745 G -> A LOC_Os02g38330.1 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:96.502; most accessible tissue: Minghui63 panicle, score: 99.037 N N N N
vg0223177745 G -> A LOC_Os02g38320.1 downstream_gene_variant ; 3052.0bp to feature; MODIFIER silent_mutation Average:96.502; most accessible tissue: Minghui63 panicle, score: 99.037 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223177745 G A 0.04 0.03 0.03 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223177745 NA 1.34E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 2.90E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 2.37E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 3.12E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 8.53E-06 NA mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 8.19E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 8.06E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 3.22E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223177745 NA 5.38E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251