\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223171948:

Variant ID: vg0223171948 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23171948
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTAAAAAATATATGATCTTATTAAAGTACTTTTTAAGATTAATCTATACATGTAGTCACTATGTTTGAAAGACAAATATTTTTAAAATAATTCATAAT[C/T]
AAAGATTTTAAAGTTTGACCTCACCCTTATCTAAAACGACAAGTATTATCAACTCGAAGGGAGCAACTACTCAAACTTTTTAGACCAAGGCCGCCACCGA

Reverse complement sequence

TCGGTGGCGGCCTTGGTCTAAAAAGTTTGAGTAGTTGCTCCCTTCGAGTTGATAATACTTGTCGTTTTAGATAAGGGTGAGGTCAAACTTTAAAATCTTT[G/A]
ATTATGAATTATTTTAAAAATATTTGTCTTTCAAACATAGTGACTACATGTATAGATTAATCTTAAAAAGTACTTTAATAAGATCATATATTTTTTAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.50% 0.78% 0.00% NA
All Indica  2759 89.40% 10.30% 0.29% 0.00% NA
All Japonica  1512 85.60% 12.60% 1.85% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 78.70% 20.40% 0.86% 0.00% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 86.00% 13.70% 0.25% 0.00% NA
Temperate Japonica  767 96.60% 1.30% 2.09% 0.00% NA
Tropical Japonica  504 68.30% 30.20% 1.59% 0.00% NA
Japonica Intermediate  241 86.70% 11.60% 1.66% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223171948 C -> T LOC_Os02g38320.1 upstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:58.545; most accessible tissue: Callus, score: 90.121 N N N N
vg0223171948 C -> T LOC_Os02g38330.1 downstream_gene_variant ; 3979.0bp to feature; MODIFIER silent_mutation Average:58.545; most accessible tissue: Callus, score: 90.121 N N N N
vg0223171948 C -> T LOC_Os02g38310-LOC_Os02g38320 intergenic_region ; MODIFIER silent_mutation Average:58.545; most accessible tissue: Callus, score: 90.121 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223171948 C T 0.0 0.04 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223171948 NA 6.74E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223171948 NA 1.74E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223171948 NA 3.07E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223171948 NA 3.28E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223171948 3.53E-06 3.53E-06 mr1846_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251