| Variant ID: vg0223168818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23168818 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 107. )
TTAGCAATTTGGATTCAAAAAAGTTTTTTTCTGAGTAAAGTGTATGGACGGTCCTTAAATTTATAGCGGTATGTCATCTAGGTTCTTAAACTCTCAAAAT[G/A]
CATATACAAGTTCCAGAACTTGTCATAGTGTGTCATCTAGATCCCAAATCGCCACAGCCCCTTCAGGATCCTACATGGTGCTTGTGGTGCTGATGTGGCA
TGCCACATCAGCACCACAAGCACCATGTAGGATCCTGAAGGGGCTGTGGCGATTTGGGATCTAGATGACACACTATGACAAGTTCTGGAACTTGTATATG[C/T]
ATTTTGAGAGTTTAAGAACCTAGATGACATACCGCTATAAATTTAAGGACCGTCCATACACTTTACTCAGAAAAAAACTTTTTTGAATCCAAATTGCTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 43.40% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 76.90% | 22.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.80% | 23.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.60% | 5.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 67.30% | 32.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.50% | 22.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.90% | 68.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 64.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223168818 | G -> A | LOC_Os02g38310.1 | upstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:56.05; most accessible tissue: Minghui63 root, score: 83.807 | N | N | N | N |
| vg0223168818 | G -> A | LOC_Os02g38320.1 | upstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:56.05; most accessible tissue: Minghui63 root, score: 83.807 | N | N | N | N |
| vg0223168818 | G -> A | LOC_Os02g38310-LOC_Os02g38320 | intergenic_region ; MODIFIER | silent_mutation | Average:56.05; most accessible tissue: Minghui63 root, score: 83.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223168818 | NA | 6.35E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 3.47E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 5.43E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 1.35E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 9.73E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 1.16E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 8.05E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 2.23E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 1.04E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223168818 | NA | 6.40E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/